ID: 912956432

View in Genome Browser
Species Human (GRCh38)
Location 1:114156877-114156899
Sequence TACATGAGGGAGAAAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912956426_912956432 4 Left 912956426 1:114156850-114156872 CCTTCCAGCAACAGCACTCTAGG No data
Right 912956432 1:114156877-114156899 TACATGAGGGAGAAAAGAGGAGG No data
912956428_912956432 0 Left 912956428 1:114156854-114156876 CCAGCAACAGCACTCTAGGATTT No data
Right 912956432 1:114156877-114156899 TACATGAGGGAGAAAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912956432 Original CRISPR TACATGAGGGAGAAAAGAGG AGG Intergenic
No off target data available for this crispr