ID: 912956723

View in Genome Browser
Species Human (GRCh38)
Location 1:114159143-114159165
Sequence ATGGTGTCATTGATAAAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912956720_912956723 1 Left 912956720 1:114159119-114159141 CCCAGTTACTGGTCTAGAGGAAA No data
Right 912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG No data
912956714_912956723 28 Left 912956714 1:114159092-114159114 CCTTAGCCATTTCAGTTGCCTCT No data
Right 912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG No data
912956718_912956723 10 Left 912956718 1:114159110-114159132 CCTCTTGGACCCAGTTACTGGTC No data
Right 912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG No data
912956716_912956723 22 Left 912956716 1:114159098-114159120 CCATTTCAGTTGCCTCTTGGACC No data
Right 912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG No data
912956721_912956723 0 Left 912956721 1:114159120-114159142 CCAGTTACTGGTCTAGAGGAAAG No data
Right 912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912956723 Original CRISPR ATGGTGTCATTGATAAAATA CGG Intergenic
No off target data available for this crispr