ID: 912958495

View in Genome Browser
Species Human (GRCh38)
Location 1:114173846-114173868
Sequence GCAGAGAGTTAGATTTAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912958493_912958495 4 Left 912958493 1:114173819-114173841 CCAGACATGATTGTAGGTGAAGA No data
Right 912958495 1:114173846-114173868 GCAGAGAGTTAGATTTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912958495 Original CRISPR GCAGAGAGTTAGATTTAATC AGG Intergenic
No off target data available for this crispr