ID: 912961656

View in Genome Browser
Species Human (GRCh38)
Location 1:114201405-114201427
Sequence TCTCACCCCTCTAGTGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912961656_912961659 3 Left 912961656 1:114201405-114201427 CCATGGGCACTAGAGGGGTGAGA No data
Right 912961659 1:114201431-114201453 AGCAAAAATGAACCTGCATGGGG No data
912961656_912961664 28 Left 912961656 1:114201405-114201427 CCATGGGCACTAGAGGGGTGAGA No data
Right 912961664 1:114201456-114201478 CTGGTTCAGTAGCAGCAATGGGG No data
912961656_912961658 2 Left 912961656 1:114201405-114201427 CCATGGGCACTAGAGGGGTGAGA No data
Right 912961658 1:114201430-114201452 AAGCAAAAATGAACCTGCATGGG No data
912961656_912961662 26 Left 912961656 1:114201405-114201427 CCATGGGCACTAGAGGGGTGAGA No data
Right 912961662 1:114201454-114201476 AGCTGGTTCAGTAGCAGCAATGG No data
912961656_912961660 9 Left 912961656 1:114201405-114201427 CCATGGGCACTAGAGGGGTGAGA No data
Right 912961660 1:114201437-114201459 AATGAACCTGCATGGGGAGCTGG No data
912961656_912961663 27 Left 912961656 1:114201405-114201427 CCATGGGCACTAGAGGGGTGAGA No data
Right 912961663 1:114201455-114201477 GCTGGTTCAGTAGCAGCAATGGG No data
912961656_912961657 1 Left 912961656 1:114201405-114201427 CCATGGGCACTAGAGGGGTGAGA No data
Right 912961657 1:114201429-114201451 AAAGCAAAAATGAACCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912961656 Original CRISPR TCTCACCCCTCTAGTGCCCA TGG (reversed) Intergenic
No off target data available for this crispr