ID: 912961661

View in Genome Browser
Species Human (GRCh38)
Location 1:114201443-114201465
Sequence ACTGAACCAGCTCCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912961661_912961664 -10 Left 912961661 1:114201443-114201465 CCTGCATGGGGAGCTGGTTCAGT No data
Right 912961664 1:114201456-114201478 CTGGTTCAGTAGCAGCAATGGGG No data
912961661_912961666 -1 Left 912961661 1:114201443-114201465 CCTGCATGGGGAGCTGGTTCAGT No data
Right 912961666 1:114201465-114201487 TAGCAGCAATGGGGCTCCCAGGG No data
912961661_912961671 29 Left 912961661 1:114201443-114201465 CCTGCATGGGGAGCTGGTTCAGT No data
Right 912961671 1:114201495-114201517 AAGGCAAGCTGCAAGATACAAGG No data
912961661_912961667 10 Left 912961661 1:114201443-114201465 CCTGCATGGGGAGCTGGTTCAGT No data
Right 912961667 1:114201476-114201498 GGGCTCCCAGGGATTGTCCAAGG No data
912961661_912961665 -2 Left 912961661 1:114201443-114201465 CCTGCATGGGGAGCTGGTTCAGT No data
Right 912961665 1:114201464-114201486 GTAGCAGCAATGGGGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912961661 Original CRISPR ACTGAACCAGCTCCCCATGC AGG (reversed) Intergenic
No off target data available for this crispr