ID: 912961664

View in Genome Browser
Species Human (GRCh38)
Location 1:114201456-114201478
Sequence CTGGTTCAGTAGCAGCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912961661_912961664 -10 Left 912961661 1:114201443-114201465 CCTGCATGGGGAGCTGGTTCAGT No data
Right 912961664 1:114201456-114201478 CTGGTTCAGTAGCAGCAATGGGG No data
912961656_912961664 28 Left 912961656 1:114201405-114201427 CCATGGGCACTAGAGGGGTGAGA No data
Right 912961664 1:114201456-114201478 CTGGTTCAGTAGCAGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912961664 Original CRISPR CTGGTTCAGTAGCAGCAATG GGG Intergenic
No off target data available for this crispr