ID: 912961664 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:114201456-114201478 |
Sequence | CTGGTTCAGTAGCAGCAATG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912961661_912961664 | -10 | Left | 912961661 | 1:114201443-114201465 | CCTGCATGGGGAGCTGGTTCAGT | No data | ||
Right | 912961664 | 1:114201456-114201478 | CTGGTTCAGTAGCAGCAATGGGG | No data | ||||
912961656_912961664 | 28 | Left | 912961656 | 1:114201405-114201427 | CCATGGGCACTAGAGGGGTGAGA | No data | ||
Right | 912961664 | 1:114201456-114201478 | CTGGTTCAGTAGCAGCAATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912961664 | Original CRISPR | CTGGTTCAGTAGCAGCAATG GGG | Intergenic | ||
No off target data available for this crispr |