ID: 912963229

View in Genome Browser
Species Human (GRCh38)
Location 1:114214413-114214435
Sequence ACAGTTTACCAGCACCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912963229_912963230 22 Left 912963229 1:114214413-114214435 CCAGTGGGGTGCTGGTAAACTGT No data
Right 912963230 1:114214458-114214480 AAAGAAAGAAAGCATTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912963229 Original CRISPR ACAGTTTACCAGCACCCCAC TGG (reversed) Intergenic
No off target data available for this crispr