ID: 912963381

View in Genome Browser
Species Human (GRCh38)
Location 1:114215930-114215952
Sequence CCTCTCCTGCAGGAGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912963381_912963387 6 Left 912963381 1:114215930-114215952 CCTATCTCCTCCTGCAGGAGAGG No data
Right 912963387 1:114215959-114215981 TTGGCCCCAGCCTCCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912963381 Original CRISPR CCTCTCCTGCAGGAGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr