ID: 912963814

View in Genome Browser
Species Human (GRCh38)
Location 1:114219517-114219539
Sequence AGCACGGATGAATCTACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912963814_912963824 30 Left 912963814 1:114219517-114219539 CCCTTTGTAGATTCATCCGTGCT No data
Right 912963824 1:114219570-114219592 ATGAGATGAAATCCTCTTTGTGG No data
912963814_912963819 1 Left 912963814 1:114219517-114219539 CCCTTTGTAGATTCATCCGTGCT No data
Right 912963819 1:114219541-114219563 CCCTGACACCTCCTGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912963814 Original CRISPR AGCACGGATGAATCTACAAA GGG (reversed) Intergenic
No off target data available for this crispr