ID: 912965697

View in Genome Browser
Species Human (GRCh38)
Location 1:114235350-114235372
Sequence CTTTTTCTCCAGAAGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912965692_912965697 18 Left 912965692 1:114235309-114235331 CCAGTCCTCAGTTCTAATGGCTG No data
Right 912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG No data
912965689_912965697 28 Left 912965689 1:114235299-114235321 CCCTGACTTTCCAGTCCTCAGTT No data
Right 912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG No data
912965694_912965697 -10 Left 912965694 1:114235337-114235359 CCCAACTGTACCTCTTTTTCTCC No data
Right 912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG No data
912965690_912965697 27 Left 912965690 1:114235300-114235322 CCTGACTTTCCAGTCCTCAGTTC No data
Right 912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG No data
912965693_912965697 13 Left 912965693 1:114235314-114235336 CCTCAGTTCTAATGGCTGCAAAA No data
Right 912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912965697 Original CRISPR CTTTTTCTCCAGAAGCCCTG AGG Intergenic
No off target data available for this crispr