ID: 912967523

View in Genome Browser
Species Human (GRCh38)
Location 1:114249268-114249290
Sequence CAATGCTGCAGTCTGAATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912967521_912967523 -2 Left 912967521 1:114249247-114249269 CCAAGAAGAGCACAGAGTCAGCA No data
Right 912967523 1:114249268-114249290 CAATGCTGCAGTCTGAATGGCGG No data
912967519_912967523 29 Left 912967519 1:114249216-114249238 CCTGTGGCTCTAAATCAATGGCA No data
Right 912967523 1:114249268-114249290 CAATGCTGCAGTCTGAATGGCGG No data
912967518_912967523 30 Left 912967518 1:114249215-114249237 CCCTGTGGCTCTAAATCAATGGC No data
Right 912967523 1:114249268-114249290 CAATGCTGCAGTCTGAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912967523 Original CRISPR CAATGCTGCAGTCTGAATGG CGG Intergenic
No off target data available for this crispr