ID: 912967704

View in Genome Browser
Species Human (GRCh38)
Location 1:114250757-114250779
Sequence CATTATTAAATCAAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912967702_912967704 1 Left 912967702 1:114250733-114250755 CCTGGTAAGCAGGGGCTCCTCTA No data
Right 912967704 1:114250757-114250779 CATTATTAAATCAAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912967704 Original CRISPR CATTATTAAATCAAAGAGAG AGG Intergenic
No off target data available for this crispr