ID: 912968676

View in Genome Browser
Species Human (GRCh38)
Location 1:114259949-114259971
Sequence CAGGGTACAGAGTTTCAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912968676_912968686 16 Left 912968676 1:114259949-114259971 CCACATTGAAACTCTGTACCCTG No data
Right 912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG No data
912968676_912968678 -10 Left 912968676 1:114259949-114259971 CCACATTGAAACTCTGTACCCTG No data
Right 912968678 1:114259962-114259984 CTGTACCCTGGCCACACCTCTGG No data
912968676_912968688 22 Left 912968676 1:114259949-114259971 CCACATTGAAACTCTGTACCCTG No data
Right 912968688 1:114259994-114260016 CACCACACTGAGGTGGGAGGAGG No data
912968676_912968685 15 Left 912968676 1:114259949-114259971 CCACATTGAAACTCTGTACCCTG No data
Right 912968685 1:114259987-114260009 TCACAGTCACCACACTGAGGTGG No data
912968676_912968687 19 Left 912968676 1:114259949-114259971 CCACATTGAAACTCTGTACCCTG No data
Right 912968687 1:114259991-114260013 AGTCACCACACTGAGGTGGGAGG No data
912968676_912968679 -9 Left 912968676 1:114259949-114259971 CCACATTGAAACTCTGTACCCTG No data
Right 912968679 1:114259963-114259985 TGTACCCTGGCCACACCTCTGGG No data
912968676_912968684 12 Left 912968676 1:114259949-114259971 CCACATTGAAACTCTGTACCCTG No data
Right 912968684 1:114259984-114260006 GGCTCACAGTCACCACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912968676 Original CRISPR CAGGGTACAGAGTTTCAATG TGG (reversed) Intergenic
No off target data available for this crispr