ID: 912968681

View in Genome Browser
Species Human (GRCh38)
Location 1:114259968-114259990
Sequence GTGAGCCCAGAGGTGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912968681_912968686 -3 Left 912968681 1:114259968-114259990 CCTGGCCACACCTCTGGGCTCAC No data
Right 912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG No data
912968681_912968688 3 Left 912968681 1:114259968-114259990 CCTGGCCACACCTCTGGGCTCAC No data
Right 912968688 1:114259994-114260016 CACCACACTGAGGTGGGAGGAGG No data
912968681_912968684 -7 Left 912968681 1:114259968-114259990 CCTGGCCACACCTCTGGGCTCAC No data
Right 912968684 1:114259984-114260006 GGCTCACAGTCACCACACTGAGG No data
912968681_912968685 -4 Left 912968681 1:114259968-114259990 CCTGGCCACACCTCTGGGCTCAC No data
Right 912968685 1:114259987-114260009 TCACAGTCACCACACTGAGGTGG No data
912968681_912968687 0 Left 912968681 1:114259968-114259990 CCTGGCCACACCTCTGGGCTCAC No data
Right 912968687 1:114259991-114260013 AGTCACCACACTGAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912968681 Original CRISPR GTGAGCCCAGAGGTGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr