ID: 912968682

View in Genome Browser
Species Human (GRCh38)
Location 1:114259973-114259995
Sequence TGACTGTGAGCCCAGAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912968682_912968685 -9 Left 912968682 1:114259973-114259995 CCACACCTCTGGGCTCACAGTCA No data
Right 912968685 1:114259987-114260009 TCACAGTCACCACACTGAGGTGG No data
912968682_912968688 -2 Left 912968682 1:114259973-114259995 CCACACCTCTGGGCTCACAGTCA No data
Right 912968688 1:114259994-114260016 CACCACACTGAGGTGGGAGGAGG No data
912968682_912968687 -5 Left 912968682 1:114259973-114259995 CCACACCTCTGGGCTCACAGTCA No data
Right 912968687 1:114259991-114260013 AGTCACCACACTGAGGTGGGAGG No data
912968682_912968686 -8 Left 912968682 1:114259973-114259995 CCACACCTCTGGGCTCACAGTCA No data
Right 912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912968682 Original CRISPR TGACTGTGAGCCCAGAGGTG TGG (reversed) Intergenic
No off target data available for this crispr