ID: 912968686

View in Genome Browser
Species Human (GRCh38)
Location 1:114259988-114260010
Sequence CACAGTCACCACACTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912968675_912968686 23 Left 912968675 1:114259942-114259964 CCAATGTCCACATTGAAACTCTG No data
Right 912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG No data
912968676_912968686 16 Left 912968676 1:114259949-114259971 CCACATTGAAACTCTGTACCCTG No data
Right 912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG No data
912968680_912968686 -2 Left 912968680 1:114259967-114259989 CCCTGGCCACACCTCTGGGCTCA No data
Right 912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG No data
912968681_912968686 -3 Left 912968681 1:114259968-114259990 CCTGGCCACACCTCTGGGCTCAC No data
Right 912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG No data
912968682_912968686 -8 Left 912968682 1:114259973-114259995 CCACACCTCTGGGCTCACAGTCA No data
Right 912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912968686 Original CRISPR CACAGTCACCACACTGAGGT GGG Intergenic
No off target data available for this crispr