ID: 912969680

View in Genome Browser
Species Human (GRCh38)
Location 1:114269082-114269104
Sequence CCAAGTTTCTCCCAGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912969680_912969692 19 Left 912969680 1:114269082-114269104 CCTGCACCCTGGGAGAAACTTGG No data
Right 912969692 1:114269124-114269146 GGCAGGGGAAGAGGAGAGTTTGG No data
912969680_912969684 -3 Left 912969680 1:114269082-114269104 CCTGCACCCTGGGAGAAACTTGG No data
Right 912969684 1:114269102-114269124 TGGATGACACAGCCACCTAATGG No data
912969680_912969686 2 Left 912969680 1:114269082-114269104 CCTGCACCCTGGGAGAAACTTGG No data
Right 912969686 1:114269107-114269129 GACACAGCCACCTAATGGGCAGG No data
912969680_912969688 4 Left 912969680 1:114269082-114269104 CCTGCACCCTGGGAGAAACTTGG No data
Right 912969688 1:114269109-114269131 CACAGCCACCTAATGGGCAGGGG No data
912969680_912969687 3 Left 912969680 1:114269082-114269104 CCTGCACCCTGGGAGAAACTTGG No data
Right 912969687 1:114269108-114269130 ACACAGCCACCTAATGGGCAGGG No data
912969680_912969685 -2 Left 912969680 1:114269082-114269104 CCTGCACCCTGGGAGAAACTTGG No data
Right 912969685 1:114269103-114269125 GGATGACACAGCCACCTAATGGG No data
912969680_912969690 10 Left 912969680 1:114269082-114269104 CCTGCACCCTGGGAGAAACTTGG No data
Right 912969690 1:114269115-114269137 CACCTAATGGGCAGGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912969680 Original CRISPR CCAAGTTTCTCCCAGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr