ID: 912971081

View in Genome Browser
Species Human (GRCh38)
Location 1:114283803-114283825
Sequence CAGAACACTCACATTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912971081_912971083 25 Left 912971081 1:114283803-114283825 CCTCTTTAAATGTGAGTGTTCTG No data
Right 912971083 1:114283851-114283873 ACTGCATATCCACAGAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912971081 Original CRISPR CAGAACACTCACATTTAAAG AGG (reversed) Intergenic
No off target data available for this crispr