ID: 912972147

View in Genome Browser
Species Human (GRCh38)
Location 1:114293672-114293694
Sequence CTGGAGGAAGGCTGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912972147_912972152 -7 Left 912972147 1:114293672-114293694 CCAGTTTCCCAGCCTTCCTCCAG No data
Right 912972152 1:114293688-114293710 CCTCCAGAAGTGCACCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912972147 Original CRISPR CTGGAGGAAGGCTGGGAAAC TGG (reversed) Intergenic
No off target data available for this crispr