ID: 912972152

View in Genome Browser
Species Human (GRCh38)
Location 1:114293688-114293710
Sequence CCTCCAGAAGTGCACCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912972144_912972152 8 Left 912972144 1:114293657-114293679 CCAAGAGTGTGGACCCCAGTTTC No data
Right 912972152 1:114293688-114293710 CCTCCAGAAGTGCACCCCCAAGG No data
912972142_912972152 20 Left 912972142 1:114293645-114293667 CCAAGGGGAGAGCCAAGAGTGTG No data
Right 912972152 1:114293688-114293710 CCTCCAGAAGTGCACCCCCAAGG No data
912972147_912972152 -7 Left 912972147 1:114293672-114293694 CCAGTTTCCCAGCCTTCCTCCAG No data
Right 912972152 1:114293688-114293710 CCTCCAGAAGTGCACCCCCAAGG No data
912972145_912972152 -5 Left 912972145 1:114293670-114293692 CCCCAGTTTCCCAGCCTTCCTCC No data
Right 912972152 1:114293688-114293710 CCTCCAGAAGTGCACCCCCAAGG No data
912972146_912972152 -6 Left 912972146 1:114293671-114293693 CCCAGTTTCCCAGCCTTCCTCCA No data
Right 912972152 1:114293688-114293710 CCTCCAGAAGTGCACCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912972152 Original CRISPR CCTCCAGAAGTGCACCCCCA AGG Intergenic
No off target data available for this crispr