ID: 912975748

View in Genome Browser
Species Human (GRCh38)
Location 1:114328731-114328753
Sequence GATGCAGGTGCCCTACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912975748_912975755 14 Left 912975748 1:114328731-114328753 CCTTCCTGTAGGGCACCTGCATC No data
Right 912975755 1:114328768-114328790 GCCACTGACACTGCCACCCAAGG No data
912975748_912975757 20 Left 912975748 1:114328731-114328753 CCTTCCTGTAGGGCACCTGCATC No data
Right 912975757 1:114328774-114328796 GACACTGCCACCCAAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912975748 Original CRISPR GATGCAGGTGCCCTACAGGA AGG (reversed) Intergenic
No off target data available for this crispr