ID: 912977152

View in Genome Browser
Species Human (GRCh38)
Location 1:114341182-114341204
Sequence CCTACTGTGTGGAAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912977144_912977152 0 Left 912977144 1:114341159-114341181 CCATCTTCACTCCCTTCCTCCAT No data
Right 912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG No data
912977142_912977152 24 Left 912977142 1:114341135-114341157 CCCTTAAAGGAGGTGGGGAGGAT No data
Right 912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG No data
912977143_912977152 23 Left 912977143 1:114341136-114341158 CCTTAAAGGAGGTGGGGAGGATA No data
Right 912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912977152 Original CRISPR CCTACTGTGTGGAAGGAACA TGG Intergenic
No off target data available for this crispr