ID: 912978435

View in Genome Browser
Species Human (GRCh38)
Location 1:114350117-114350139
Sequence GCTATGTCCGCAGCCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912978435_912978439 12 Left 912978435 1:114350117-114350139 CCTGAAGGGGCTGCGGACATAGC No data
Right 912978439 1:114350152-114350174 GAATGAATTCCACATGAAAATGG No data
912978435_912978440 13 Left 912978435 1:114350117-114350139 CCTGAAGGGGCTGCGGACATAGC No data
Right 912978440 1:114350153-114350175 AATGAATTCCACATGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912978435 Original CRISPR GCTATGTCCGCAGCCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr