ID: 912978540

View in Genome Browser
Species Human (GRCh38)
Location 1:114350807-114350829
Sequence CAGCACGGAGATCCCTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912978540_912978544 1 Left 912978540 1:114350807-114350829 CCTGGGCAGGGATCTCCGTGCTG No data
Right 912978544 1:114350831-114350853 TGGTGAGGAGACATTGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912978540 Original CRISPR CAGCACGGAGATCCCTGCCC AGG (reversed) Intergenic
No off target data available for this crispr