ID: 912978988

View in Genome Browser
Species Human (GRCh38)
Location 1:114353632-114353654
Sequence CCTTTAGTCTGGTTTGCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912978983_912978988 -9 Left 912978983 1:114353618-114353640 CCATCCTTGGTTTCCCTTTAGTC No data
Right 912978988 1:114353632-114353654 CCTTTAGTCTGGTTTGCTTAAGG No data
912978980_912978988 29 Left 912978980 1:114353580-114353602 CCAGTCTGAAACATAAAGAAATA No data
Right 912978988 1:114353632-114353654 CCTTTAGTCTGGTTTGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912978988 Original CRISPR CCTTTAGTCTGGTTTGCTTA AGG Intergenic