ID: 912990040

View in Genome Browser
Species Human (GRCh38)
Location 1:114476856-114476878
Sequence CAAAATCCAGATAGTTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912990039_912990040 -6 Left 912990039 1:114476839-114476861 CCATTTTAAAAAAAATACAAAAT 0: 1
1: 5
2: 102
3: 1580
4: 18836
Right 912990040 1:114476856-114476878 CAAAATCCAGATAGTTATACAGG 0: 1
1: 0
2: 1
3: 17
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912990040 Original CRISPR CAAAATCCAGATAGTTATAC AGG Intronic
908524936 1:64978637-64978659 CAAAATCCATTCAGTTTTACAGG + Intergenic
909020135 1:70421952-70421974 CAAAATGGAGATAATTATACCGG + Intronic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
910028152 1:82683010-82683032 CTAATTCCAGAAAGTGATACTGG - Intergenic
910998330 1:93133390-93133412 CAAAAACCAGACAATTATACTGG - Intronic
911495428 1:98625254-98625276 TAAAATTCAGAAAGTTATATAGG - Intergenic
911588777 1:99721932-99721954 CAACATCCAGACCGTTATATGGG + Intronic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912990040 1:114476856-114476878 CAAAATCCAGATAGTTATACAGG + Intronic
915131662 1:153699317-153699339 CCAAAGACAGATAGTCATACTGG - Intergenic
917912714 1:179667745-179667767 AAAACTCCAGATAGCTATACTGG - Intronic
919016615 1:192046172-192046194 TAAAATACAGATAATTAAACTGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
921931619 1:220759184-220759206 GAAAATCCAGATACTTTTACTGG - Intronic
1066591288 10:36997353-36997375 AAAAATCCAGATAGGAAGACAGG - Intergenic
1068448689 10:57158455-57158477 CAAATTCCAGAAAGGTATAATGG + Intergenic
1068473569 10:57496105-57496127 CAAATTTTAGATAGTTATAAAGG + Intergenic
1071046579 10:81386856-81386878 CATAATCCAGATATTTCTTCTGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1078604232 11:12760949-12760971 CATAATCCACAGAGTTATACAGG - Intronic
1079605560 11:22361067-22361089 CAAAACCCAGATGGTTTTACAGG - Intronic
1080729275 11:34932234-34932256 CAAAATCCAGATTATAATATGGG + Intronic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1084049654 11:66591602-66591624 CACCAGCCAGATGGTTATACAGG + Exonic
1085897001 11:80651927-80651949 AAAAATCCAGATAGGAAGACAGG + Intergenic
1086606069 11:88697889-88697911 AAAAACCCAGAGAGTCATACTGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1089744072 11:120604708-120604730 CAAGATCCAGATAGATTTACAGG + Intronic
1093728404 12:22542005-22542027 CAAAATCCACCTAGTTATCAAGG + Intronic
1093751194 12:22802367-22802389 CAAATTCCAGGTATTTATAAGGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095269582 12:40201784-40201806 CAAAATTCTGATAATTATTCTGG - Intronic
1095279835 12:40337077-40337099 CAAAATCCAGAAAGCTTTTCTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100055730 12:90507011-90507033 AAAAATGGAGATAGTTAAACTGG + Intergenic
1100860884 12:98805629-98805651 CAAAATACAGAGATTTTTACTGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107275476 13:38673694-38673716 GAAAATCCACATAGTTATTTTGG - Intergenic
1107613843 13:42144022-42144044 TAATATCCAGATATTTATAGTGG - Intronic
1108260992 13:48656292-48656314 CAAAACTCAGATAATTAAACAGG - Intronic
1108401142 13:50045294-50045316 CAAACTGCACATAGTTATATAGG - Intergenic
1108433449 13:50378125-50378147 TAAAATCCAGAAGGTTCTACAGG - Intronic
1109610268 13:64756110-64756132 CAGAACCCAGATAGATAAACTGG - Intergenic
1110020846 13:70469734-70469756 CAAACTCCCGAGAGTAATACTGG + Intergenic
1111347022 13:86972073-86972095 CATAATCCAAATGCTTATACTGG - Intergenic
1111647088 13:91044911-91044933 CAAAATTCAGATAATTTTCCCGG - Intergenic
1112077085 13:95927253-95927275 CAAAATCAAAGTATTTATACGGG + Exonic
1112764112 13:102722561-102722583 CAAAATTCAGAAAGTTTTACAGG - Intergenic
1114198727 14:20503672-20503694 CAAAATCCAGATATTCTTATGGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120663055 14:87273615-87273637 CAAAAAGCACATAGTCATACTGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1126234344 15:46365315-46365337 CAAAACCCAGATAATGATATTGG - Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127477034 15:59344498-59344520 CATAGGCCAGATAATTATACAGG - Intronic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1132916665 16:2351100-2351122 CAAAATCCAGATGGTTTCACTGG - Intergenic
1135002933 16:18791779-18791801 AAAAATCCAGATAGGAAGACAGG + Exonic
1137903775 16:52297931-52297953 AAAAATTCAGAAAGTTATAAAGG + Intergenic
1144137988 17:12317577-12317599 AATAATCCAGGGAGTTATACAGG + Intergenic
1146240319 17:31216704-31216726 CAAACTCCAAATAGATCTACAGG + Intronic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1150819377 17:68422824-68422846 CAAAATACAGAGACTTGTACAGG + Intronic
1153176870 18:2385054-2385076 CAAAATATAGATAATTATATGGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1164699552 19:30274966-30274988 AAAAATCCAGAAAATTATAAAGG - Intronic
925552499 2:5091493-5091515 ATAAATCCAGATAGGTACACAGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925823878 2:7827763-7827785 TAACATCCATATAGTTAGACAGG - Intergenic
928759483 2:34565222-34565244 CAAAGATCAGATAGTTGTACTGG + Intergenic
928975892 2:37086108-37086130 CAAAATCCTGTTGGTTACACAGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931350527 2:61484185-61484207 AAAACTCCAAATATTTATACTGG - Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935723621 2:106001862-106001884 CAAAATTCTGTTGGTTATACAGG + Intergenic
935882198 2:107575854-107575876 CAAACTCCATATAGTTCTGCTGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941108476 2:161390607-161390629 CAAAATCCACATAGTTAATTTGG + Intronic
941503082 2:166305808-166305830 CAAAATCCAGCCAGTTCCACGGG + Exonic
942577829 2:177383535-177383557 GAAAATACAGAAAGTTATCCAGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946824655 2:223664737-223664759 AAAAATCCAGATTCTTCTACGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1172451645 20:35029401-35029423 CAAAAGACAGATTGTTATATTGG - Intronic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1183785688 22:40027894-40027916 CAACCTCCAGATCGTTAAACAGG - Intronic
1185141528 22:49105073-49105095 CAAACTCCTGATATTTATTCAGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
955053844 3:55438734-55438756 CAGAATCCACAAAGTTTTACTGG + Intergenic
956609276 3:71105850-71105872 TGAAATCCAGATATTTATAGTGG + Intronic
957373727 3:79329945-79329967 TAAACTCCAGATATTTTTACTGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958973540 3:100639848-100639870 CAATATCCAAATAGTTTTAAAGG + Intronic
959046624 3:101481955-101481977 CAAATTCCAGTTATTTATGCAGG - Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
960402647 3:117221809-117221831 CTAGATCCAGACAGTTTTACAGG - Intergenic
960524562 3:118695054-118695076 GAAAATCCAGGTAGAGATACTGG + Intergenic
962507832 3:136066168-136066190 CAAAGCCCAGGTAGTTTTACAGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966632195 3:182089262-182089284 CACAGACCAGATAGTTTTACTGG + Intergenic
966663035 3:182436222-182436244 CCAAATCCACATAGTTATTTTGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967674000 3:192273976-192273998 CATCAGCCAGATAATTATACAGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971600930 4:28591084-28591106 CAAACTGCAGTTAGTTTTACTGG + Intergenic
972143790 4:35995660-35995682 CAAAGTCCACACATTTATACAGG + Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975718410 4:77227601-77227623 CAGAATCCAGGGAGTTAAACAGG - Intronic
976385898 4:84457945-84457967 CAAAATCCAGAAAGTAACATTGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978406738 4:108387441-108387463 CCAAATCCAGATGGTTTCACTGG + Intergenic
978487685 4:109274747-109274769 CAAAATTCAGCAAGTTAAACTGG + Intronic
978928352 4:114278771-114278793 AAAAATCAAGATAGTTAAAATGG - Intergenic
979503777 4:121469742-121469764 CAAGATCCAGATTGCTATATAGG - Intergenic
979869997 4:125807239-125807261 CAAACTCCAGAAATTTATATTGG - Intergenic
980431253 4:132699495-132699517 CAAAAGACAGATAGATATATTGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981611947 4:146602706-146602728 AAAGATCCAGAAAGATATACAGG - Intergenic
981880116 4:149600413-149600435 CAAAATTCAGAAAGTTAAATTGG + Intergenic
982031355 4:151304316-151304338 CACAATCCAGCTAGTTTTTCTGG - Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
985116856 4:186600144-186600166 CAAAAAACACATAGTTATCCAGG + Exonic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986943116 5:12980943-12980965 CAAAATTCAGATTGTTAAGCTGG + Intergenic
987981988 5:25097481-25097503 GAAAATCCATAAAATTATACCGG - Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988365770 5:30296582-30296604 CAAAATCAAGTATGTTATACAGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
992084866 5:73269465-73269487 AAGACTCCAGATAGTTATCCTGG + Intergenic
993374036 5:87128202-87128224 CAGCATCCAAATATTTATACTGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994403448 5:99313438-99313460 TCAAATCCAGATAGTCAGACTGG - Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995214795 5:109583041-109583063 CAAAAACCTGAAAGTTATAGGGG - Intergenic
995770731 5:115666073-115666095 CATAATCCAGATAATTTTTCTGG + Intergenic
995983365 5:118136078-118136100 CAAAATCCCGACAGTTTTTCTGG - Intergenic
998363583 5:141613034-141613056 AGAAATCCAGAAAATTATACAGG + Intronic
999324084 5:150632275-150632297 CAAAATGCAGATTGTAATTCAGG - Intronic
1000055587 5:157603331-157603353 CAAACTACAGAGAGTTATACAGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1001582298 5:172807083-172807105 CAAAATCCAGAATGTGCTACCGG - Intergenic
1001743083 5:174069674-174069696 CAAAATCCAGCTAATTAGACAGG - Intronic
1004464791 6:15874544-15874566 CTAAAGCAAGATAGTTAAACAGG + Intergenic
1009627055 6:66147295-66147317 CAAAATGGAGATAGTCATGCGGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015983515 6:138862785-138862807 CAAAATCCAGTTAATAGTACTGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020630675 7:10635936-10635958 AAAAATCCAGTTAGTGATCCAGG - Intergenic
1020926290 7:14330363-14330385 CAAAATCCAAAAAGGTACACAGG - Intronic
1030216459 7:107048087-107048109 CAAAATCAAGATTGGGATACAGG + Intronic
1030456488 7:109781123-109781145 GAAAATCCAGATACATATACAGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1034046114 7:147929527-147929549 CAAAATACAAAGTGTTATACAGG + Intronic
1036020455 8:4839023-4839045 CCAATTCCAAAAAGTTATACTGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037092589 8:14941188-14941210 CAAAATGTAGAAAGTTATATTGG - Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1042970549 8:74403611-74403633 CATAATCCATATACTTTTACTGG - Intronic
1043006968 8:74831774-74831796 CAAAATAAATAAAGTTATACAGG + Intronic
1043589004 8:81806091-81806113 TCAAATCCAGATTGTTTTACAGG + Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044789206 8:95829495-95829517 ATAAATTCAGAGAGTTATACCGG + Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046252286 8:111648026-111648048 CAAAGTCCAGAGATTTTTACTGG - Intergenic
1046697045 8:117352964-117352986 CAAAATCCAGATACTCAACCAGG + Intergenic
1050034048 9:1416231-1416253 CCAAAGGCAGATAGATATACAGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051807475 9:21011531-21011553 CAAAAGCCATCTAGTTATAATGG - Intronic
1051926491 9:22333643-22333665 TGAAATCCAAATAGCTATACAGG + Intergenic
1051926618 9:22335263-22335285 TGAAATCCAAATAGCTATACAGG - Intergenic
1051969407 9:22869164-22869186 AAAAATCCAGATTATTATTCAGG - Intergenic
1052053762 9:23880968-23880990 TAAAATCCAAAGAGATATACAGG - Intergenic
1053654824 9:40206672-40206694 CAAATTCCAAATACTTATAATGG - Intergenic
1053905215 9:42835889-42835911 CAAATTCCAAATACTTATAATGG - Intergenic
1054366939 9:64352888-64352910 CAAATTCCAAATACTTATAATGG - Intergenic
1054529774 9:66169643-66169665 CAAATTCCAAATACTTATAATGG + Intergenic
1054674569 9:67842629-67842651 CAAATTCCAAATACTTATAATGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055220404 9:73923119-73923141 CAAAATCCAGATACTTGTACTGG + Intergenic
1058277593 9:103064465-103064487 CAGAATTCAGAAAGCTATACAGG - Intergenic
1058298599 9:103340979-103341001 CAAAATCGAGAGAGTTGTCCTGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058779687 9:108320420-108320442 CAAAATGAAGATAGCTATATTGG + Intergenic
1059203250 9:112438529-112438551 CAAAAGCCAAAAAGTTTTACTGG + Exonic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059871940 9:118587344-118587366 CAAAATCCAGATGGAAAAACTGG - Intergenic
1185960133 X:4539946-4539968 CACCACCCAGATAGTTAAACTGG + Intergenic
1186115579 X:6301898-6301920 CACTACCCAGATAGTTAAACTGG - Intergenic
1186205563 X:7196741-7196763 CAAAATACAGATAGAGAGACAGG - Intergenic
1187438229 X:19292230-19292252 CAACATCCAGAAAGTTCTATTGG + Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189874228 X:45419642-45419664 CATAATCCAGATAATTCTTCTGG - Intergenic
1190027332 X:46936573-46936595 CCAGACCCAGATAGTTTTACTGG - Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191988240 X:67004970-67004992 CAAAATCCAAATAGGTTCACTGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1195341940 X:103915052-103915074 CATAATCCAGGTATTGATACAGG - Intergenic
1195926237 X:110027985-110028007 CAAAGCCCAGATAGTTTTATAGG - Intronic
1196063681 X:111439139-111439161 CCAAAACCAGATGGTTTTACTGG - Intergenic
1196977775 X:121179331-121179353 TAAATTCCAGATATTTCTACTGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1199279719 X:145986586-145986608 TAAAATCTAGATAGTTACAGTGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic