ID: 912990738

View in Genome Browser
Species Human (GRCh38)
Location 1:114483706-114483728
Sequence CCGGCCCCAGTTGGTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912990727_912990738 22 Left 912990727 1:114483661-114483683 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 912990738 1:114483706-114483728 CCGGCCCCAGTTGGTTTTAATGG No data
912990729_912990738 16 Left 912990729 1:114483667-114483689 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 912990738 1:114483706-114483728 CCGGCCCCAGTTGGTTTTAATGG No data
912990730_912990738 13 Left 912990730 1:114483670-114483692 CCCAAAGTGCTGGGATTACAGTG 0: 314
1: 7325
2: 319767
3: 274330
4: 148500
Right 912990738 1:114483706-114483728 CCGGCCCCAGTTGGTTTTAATGG No data
912990723_912990738 29 Left 912990723 1:114483654-114483676 CCACCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 912990738 1:114483706-114483728 CCGGCCCCAGTTGGTTTTAATGG No data
912990724_912990738 26 Left 912990724 1:114483657-114483679 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 912990738 1:114483706-114483728 CCGGCCCCAGTTGGTTTTAATGG No data
912990725_912990738 25 Left 912990725 1:114483658-114483680 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 912990738 1:114483706-114483728 CCGGCCCCAGTTGGTTTTAATGG No data
912990731_912990738 12 Left 912990731 1:114483671-114483693 CCAAAGTGCTGGGATTACAGTGT 0: 183
1: 1094
2: 16388
3: 329202
4: 271997
Right 912990738 1:114483706-114483728 CCGGCCCCAGTTGGTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912990738 Original CRISPR CCGGCCCCAGTTGGTTTTAA TGG Intronic
No off target data available for this crispr