ID: 912993454

View in Genome Browser
Species Human (GRCh38)
Location 1:114510980-114511002
Sequence GGCCGCCGGGCCCGCCGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 1, 2: 8, 3: 66, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912993454_912993458 -9 Left 912993454 1:114510980-114511002 CCTGCGCGGCGGGCCCGGCGGCC 0: 1
1: 1
2: 8
3: 66
4: 435
Right 912993458 1:114510994-114511016 CCGGCGGCCCCGGCAGTTACCGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912993454 Original CRISPR GGCCGCCGGGCCCGCCGCGC AGG (reversed) Exonic
900091747 1:923864-923886 GCCCGCGCCGCCCGCCGCGCCGG + Intergenic
900255033 1:1693435-1693457 GGGGGGCGGGGCCGCCGCGCGGG + Intronic
900263776 1:1746701-1746723 GGGGGGCGGGGCCGCCGCGCGGG + Intergenic
900269170 1:1778413-1778435 GGCCGCCCGGACCCCGGCGCCGG + Intronic
900283870 1:1890376-1890398 GGCGGCCGGAGCCCCCGCGCGGG - Intronic
900417232 1:2540739-2540761 GGCCGCACGCCCCGCCCCGCCGG + Intergenic
900467225 1:2831669-2831691 GGCCGTGGGGCCTGCCTCGCAGG + Intergenic
901055544 1:6447313-6447335 CGCCGCGGCGCCCCCCGCGCGGG + Intronic
901540108 1:9910136-9910158 GGCCGCCGCGCGCTGCGCGCCGG - Exonic
901691178 1:10974152-10974174 GGCAGCCCGGCCCGCAGCCCTGG - Intronic
902823312 1:18956434-18956456 AACCGCCCGGCCGGCCGCGCTGG - Exonic
903184760 1:21622655-21622677 GGCGGCCCGGCCCGCGGCCCCGG + Intronic
903420916 1:23217406-23217428 GGCCGCCCGCCCCGCCGCCCCGG + Intergenic
903468372 1:23568136-23568158 GGCCGCCGGGCGCGGGGCGCGGG - Intergenic
903750620 1:25618147-25618169 GGCCGCCGTGGCCTCCTCGCGGG - Exonic
903950674 1:26994302-26994324 GGCCGCGGCGGCCGCGGCGCGGG - Exonic
904039478 1:27575749-27575771 TTCCGCCGGGCCCGGGGCGCGGG - Intronic
904318300 1:29680231-29680253 GGCCCCCTGGCCCGCCGCAGGGG + Intergenic
904587699 1:31589051-31589073 GGCCCCGGGACCCGCCCCGCCGG + Intergenic
904744464 1:32702621-32702643 CGGCGCCGTCCCCGCCGCGCCGG + Exonic
904753221 1:32754018-32754040 GGCCGCCGGGCCCGCAGCCCCGG - Intronic
904769041 1:32870834-32870856 AGCGGCCGGGCCGGCCGGGCCGG - Intronic
905066890 1:35192251-35192273 GGCCGCCGGGCCCGCCGGGCGGG + Exonic
905442795 1:38005582-38005604 GGCCCCCCAGCCCGCCGCGGGGG + Intronic
905648210 1:39639468-39639490 GCCCGACGGGCTCGCCGAGCAGG - Intronic
905867102 1:41382356-41382378 GCCCGCGGCGCCCGCCTCGCCGG - Exonic
906318008 1:44800511-44800533 GGCCGCCGCGCCCGCTCCCCCGG + Exonic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906680935 1:47725147-47725169 GGGCGCATGGCCGGCCGCGCCGG + Intergenic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
908501110 1:64744900-64744922 GGCCCCCGGCCCCGGCGCACAGG - Intergenic
908796247 1:67833447-67833469 GGGCGCCGGCTCCGCCTCGCTGG + Exonic
909001414 1:70221678-70221700 CGCCACCGGGCCCGCCGCTGGGG - Exonic
909585219 1:77281877-77281899 GGCTGCCGGTCACGCTGCGCGGG - Intergenic
910200152 1:84690567-84690589 GGCGGCGGGGCCTGCGGCGCCGG - Intronic
910232157 1:84997675-84997697 TGCCGCAGGGCCCACCGCCCGGG - Intergenic
910449013 1:87328589-87328611 GCCGGCCGGGCCCGGCGCGCTGG - Exonic
910759185 1:90718406-90718428 GGCTGCGAGGGCCGCCGCGCTGG - Intergenic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
914197337 1:145454429-145454451 CCCCGCCGGCCCCGCCGCCCCGG + Intergenic
916666941 1:166975388-166975410 GGGCGCAGCGCCCGCCGGGCCGG + Intronic
916666942 1:166975397-166975419 GCCCGCCGGGCCGGCCGCGCAGG + Intronic
916666982 1:166975543-166975565 CGCCGCAGAGCCCGCCGCGCGGG + Intergenic
917788856 1:178486915-178486937 GGCCGCTGGGCCCGCGGAGGCGG + Intergenic
921189926 1:212699938-212699960 GGCTGCCGGGACTGGCGCGCGGG - Exonic
921923137 1:220690447-220690469 GCCCTCGGGGCCCGCGGCGCAGG - Exonic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
922239970 1:223749043-223749065 GGCCTCCGAGTCCGCGGCGCTGG - Exonic
922250578 1:223845816-223845838 GTCCGAAGGGCCCTCCGCGCGGG + Exonic
922440649 1:225653022-225653044 GGCGGCCGGGCGCGCGGCCCCGG - Exonic
923506303 1:234609255-234609277 GGCGGCCGAGGCCGCGGCGCCGG + Exonic
924188267 1:241519430-241519452 GGCCGGGAGGCCCGCCACGCCGG + Intronic
1062890459 10:1056429-1056451 GGCCGCGGTGCCGGCCGCGCGGG - Intronic
1063418234 10:5890292-5890314 CGCCGCCGGGCCCGCGCCGCCGG - Intronic
1064086524 10:12349748-12349770 GGGCGCCGGGGGCGCGGCGCGGG - Exonic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1066180633 10:32958049-32958071 AGCCGCCGGCCGGGCCGCGCCGG - Intronic
1066429345 10:35336888-35336910 GGCCGCCGGGTCAGCAGCGGCGG - Exonic
1067362360 10:45594556-45594578 CCACGCCGGGCCCGCAGCGCAGG + Intronic
1067694375 10:48524266-48524288 GGCCGGCATGCCCGCTGCGCGGG - Intronic
1067852430 10:49762224-49762246 GGCCGCCGCGCTCACCGGGCGGG + Exonic
1068910500 10:62374316-62374338 CGCCGCCGGTCCCGGCGCGGAGG + Exonic
1069992955 10:72326051-72326073 GCCCGCCGGCCCTGCCGCCCCGG + Intergenic
1070290667 10:75111520-75111542 GGCCGCCGTCACCGCCGCGCCGG - Intronic
1070305350 10:75235886-75235908 GCTCTCCGTGCCCGCCGCGCTGG - Exonic
1073139691 10:101238953-101238975 GGCCGCCGCGCTCCCCGCGCGGG + Intergenic
1074503091 10:114043841-114043863 GCGCGCCGGGCCCGCAGCTCCGG - Intergenic
1076821681 10:132942768-132942790 GGACGCCGGGGGCTCCGCGCGGG + Intronic
1077049784 11:561411-561433 GGCCGCGGGGCCTGGCGTGCGGG + Exonic
1077090753 11:777267-777289 GGCCGCTGGGGGCGCCGGGCAGG - Intronic
1077214811 11:1390830-1390852 GGCCACCGGGGCCTCCGGGCAGG + Intronic
1077514182 11:2991988-2992010 GGCAGCCGGGCGAGGCGCGCCGG + Intronic
1078246218 11:9574535-9574557 GGCGGCCGGGGCCGCGGCGCCGG + Intronic
1078334228 11:10451079-10451101 GGCCGCAGGGTCCGCGGGGCTGG - Intronic
1079128639 11:17735296-17735318 GGCAGGCGGGCCCGCCGCCGGGG + Exonic
1080628610 11:34052510-34052532 GGGAGCCGGGGCCGCCGCGCCGG + Exonic
1081428371 11:42949978-42950000 GCCGGCAGGGCCCGCCGGGCCGG - Intergenic
1082003709 11:47408550-47408572 GGCCGCCCGGCCCCCGGCCCGGG - Intronic
1082076615 11:47980465-47980487 AGCCGCCGGGCCGGCCGGGGCGG + Intergenic
1082214979 11:49558562-49558584 GGCTGCGGGGCCCGCGGCGGTGG - Intergenic
1083133318 11:60647329-60647351 GGCTGCCAGGCCCCCCGCTCAGG + Intergenic
1083258116 11:61508878-61508900 GGCCCCCGGGCCCCCCGCCCCGG - Exonic
1083316301 11:61816719-61816741 GGCCGCCGAGACCGCGGCTCAGG - Exonic
1083335143 11:61917660-61917682 CCCCACCCGGCCCGCCGCGCCGG + Intronic
1083670864 11:64299405-64299427 GGGCGGCGGGCCCGGCTCGCTGG - Exonic
1083885812 11:65572971-65572993 GGGCGCCGGGCCAGCTGGGCGGG + Intronic
1083940122 11:65891230-65891252 CGCCGCTGGGGCCGCCGCGGGGG - Exonic
1083965794 11:66042953-66042975 GGCCGCCATCCCCGCGGCGCTGG - Exonic
1084086443 11:66857304-66857326 GGCCGCCGGGCGCAGCGCGGGGG + Intronic
1084177068 11:67428516-67428538 GGCCGACGGGCCCGCGGGGCCGG + Exonic
1084310154 11:68312350-68312372 GGCCGCCGGGCCCCGCGGGGCGG + Intergenic
1085346024 11:75768706-75768728 GCCCGCCCCGCCCGCCGCGTCGG + Intronic
1086634602 11:89065907-89065929 GGCTGCGGGGCCCGCGGCGGTGG + Intronic
1088172937 11:107018206-107018228 GGCCGCGGAGCCCCCCGAGCCGG + Exonic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1088315154 11:108499113-108499135 AGCCACCGGGTCCGCCGCTCAGG + Intergenic
1089453272 11:118611005-118611027 GGCCGCGGGGCCGGGCGGGCGGG + Intronic
1090190394 11:124762764-124762786 GGCCGGAGCGCCGGCCGCGCGGG + Intergenic
1091616461 12:2053945-2053967 GGCTGCCTGGCCAGCCGCGCGGG + Intronic
1091779721 12:3206071-3206093 GGCCGCTGGGCCCTCCACCCTGG + Intronic
1094218594 12:27970600-27970622 GGCTCCCGGATCCGCCGCGCCGG - Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1094682686 12:32679694-32679716 GCTAGCCAGGCCCGCCGCGCCGG - Intronic
1096102976 12:48980530-48980552 GGCCCCCGGGGCCGCGCCGCCGG - Exonic
1099315529 12:81078243-81078265 GGCCCCCGAGACCGCCCCGCGGG - Exonic
1102025969 12:109714496-109714518 GGCCGCCGGGCTCCCAGCGCGGG + Exonic
1102278169 12:111598739-111598761 GGACGCCGGGCCCGGAGCGGAGG + Intronic
1102924915 12:116819344-116819366 GGCCTCCGGGCGTCCCGCGCCGG - Intronic
1102925003 12:116819654-116819676 GGCCACCAGCCCCGCCCCGCTGG + Intronic
1103563419 12:121804144-121804166 GGCCCCCGGTCCGGCCGCCCCGG + Intergenic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103595920 12:122024080-122024102 GGCCTCCAGGCCGGCCGCCCCGG - Intronic
1103649656 12:122422707-122422729 CGCCGCCGCGCCCGCCCGGCCGG + Intergenic
1103649661 12:122422717-122422739 GCCGGCCGGGCCGGCCGGGCGGG - Intergenic
1103764652 12:123271622-123271644 GCCCGGCGCGCCCGCCGCCCGGG - Exonic
1104966346 12:132510244-132510266 GGCAGCCGGGCCCACCCTGCCGG + Intronic
1105964428 13:25371983-25372005 GCCAGCGGGGCCCGCCGCGGTGG + Intergenic
1107133346 13:36919727-36919749 GGTCCCGGGGCCCGCGGCGCGGG + Intronic
1107467520 13:40664743-40664765 GGCGCCCGGCCCCGACGCGCTGG + Intronic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1108541993 13:51453378-51453400 GGCCGGCGGCCCTGACGCGCAGG - Intronic
1110558390 13:76885714-76885736 GGCCGCCGCCCTCGCGGCGCGGG - Exonic
1110782382 13:79481298-79481320 GGCCGCCGAGACCTCCGCGTTGG - Exonic
1111397029 13:87677428-87677450 GGCCGCCGGGCTCTTCGTGCTGG + Exonic
1111672681 13:91348746-91348768 GGACGCCGCTCCCGCCGAGCCGG - Intergenic
1112415358 13:99200165-99200187 CTCCGCCGGGCTCGCCGGGCCGG + Intergenic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1113820591 13:113209708-113209730 GGCCGCCGCGCCCGCCAAGCCGG + Exonic
1114270689 14:21098363-21098385 GGGCGGCGGGCCGGCGGCGCGGG + Exonic
1114485170 14:23057655-23057677 CGCCCCCGCCCCCGCCGCGCGGG - Intergenic
1115398582 14:32934893-32934915 GGCCGGCGGGGCGGCCGCGGGGG + Intergenic
1115566569 14:34629961-34629983 GGTCGGCGGGCACGGCGCGCCGG + Intronic
1115769342 14:36654533-36654555 GGCCCTCGGGCCCGCCTCGGAGG + Intergenic
1116223197 14:42113716-42113738 GGCCGGCGGGCTGGCCGGGCTGG + Intergenic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1118285318 14:64465543-64465565 GCTCGCGGGGCCCGCCGCCCAGG - Exonic
1118854596 14:69611467-69611489 CGCCGCCGCGACCGCCCCGCCGG - Intergenic
1120993216 14:90396860-90396882 GGCCGCCGCGACTGGCGCGCAGG + Intronic
1121074948 14:91060290-91060312 GCCGGCCGGGCCCGGCGCGGGGG - Intronic
1121616958 14:95319817-95319839 GCCCGCCGCCCGCGCCGCGCTGG - Exonic
1122275140 14:100587252-100587274 GCCGGCCGGGCCGGCTGCGCCGG - Intronic
1122631683 14:103110129-103110151 GGCCTCCGCACCCGCCGCCCCGG - Exonic
1122982203 14:105196911-105196933 GGGGGCCGTGCCCGCCCCGCTGG + Intergenic
1123036690 14:105474617-105474639 CGCCCCCGGGCCCCTCGCGCCGG - Intronic
1123162049 14:106287730-106287752 GGCCGCCGCACGTGCCGCGCGGG - Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124340469 15:28886551-28886573 TGCCGCGGTGCCCCCCGCGCGGG - Intronic
1124469193 15:29968514-29968536 GGACGCGGGGCGCGCCGCGCGGG - Intronic
1124629238 15:31327535-31327557 GGCCGCCGCGCCTTCGGCGCCGG - Exonic
1125200735 15:37099011-37099033 CGCCGCCGGGGCCGCCGCTGGGG - Intronic
1125500770 15:40239236-40239258 GGCCGCCGAGCCCCGCGCCCAGG - Intronic
1127674814 15:61228953-61228975 GGCCGCCGGACCCCGCGCCCCGG + Intronic
1127763472 15:62164082-62164104 GGCCGCCGGGCACTGCGCGTTGG - Exonic
1128149757 15:65355543-65355565 GGCGGCCGGGCCCGAGGCGGGGG + Intronic
1129612396 15:77071053-77071075 GGCTGCGGGGAGCGCCGCGCAGG - Exonic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130076577 15:80695236-80695258 GAGCGCCGCGCCCGCCGGGCCGG + Intronic
1131367781 15:91854144-91854166 GGCCGCCTGGCCCGACGAGGGGG + Intronic
1132480977 16:165955-165977 GGGGGCCGCGCCCGCCGCCCTGG - Intronic
1132519834 16:381982-382004 GCCCGCAGGCCCCGCCCCGCAGG + Exonic
1132556386 16:574544-574566 GGCAGCCAGGCCCCCCGTGCTGG - Exonic
1132679279 16:1133107-1133129 GGCCGCCGAGGCCTCCGCCCTGG - Intergenic
1132785904 16:1656888-1656910 GGCCGCCAGGACCCCCGCCCCGG + Exonic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1132828936 16:1918284-1918306 CGCCCCCGGCCCCGCCGCCCAGG + Exonic
1132884842 16:2178192-2178214 GGACGCCCGGCCAGCCGCTCGGG - Exonic
1133784337 16:8963322-8963344 GCCCGCCGGGCTCGCAGCCCCGG - Exonic
1133784405 16:8963529-8963551 GGCCGCCCGGCCCGGCCCGCCGG - Intronic
1136579402 16:31142667-31142689 GGCCGTCTGGGCCGCAGCGCGGG - Intronic
1137531473 16:49281403-49281425 GGCTGGCGGGCCCGGCCCGCGGG - Exonic
1138360642 16:56425042-56425064 GGCGGCCGGGCCCGCGGGGCAGG - Intronic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1139402864 16:66696357-66696379 GGCGGCCGAGCGCGCCGCGCAGG + Exonic
1139402873 16:66696399-66696421 GGCCGGCCAGCCCGCGGCGCTGG + Exonic
1139598124 16:67969641-67969663 GGTCGGCGGGCCCGCTGCGGGGG - Intergenic
1140927616 16:79599282-79599304 GGCCGCGCTGCCCGCGGCGCCGG + Exonic
1141553206 16:84819859-84819881 CGCCCCCGGCCCCGCCCCGCAGG - Intergenic
1142271803 16:89093822-89093844 GGGCGACGGACGCGCCGCGCCGG + Exonic
1142393093 16:89815767-89815789 GGCCACCGCGCCCGCCGCCTCGG + Intronic
1142395383 16:89828699-89828721 GGCTGCGGGGCTCGCCGGGCCGG + Exonic
1142670527 17:1485712-1485734 GGGCGCCAGGCCGGCCGGGCAGG - Intronic
1142859074 17:2749835-2749857 GGCCGCTGGGCTCGCGGAGCTGG + Intergenic
1143142005 17:4745961-4745983 CGCCGGCGGGCCCCCCGCCCAGG - Exonic
1143582668 17:7835789-7835811 GGGCGCCCGGCTCGCCGCGCAGG - Intergenic
1143747352 17:9003928-9003950 GGCCGGCGGGTCCGCGGCGCGGG - Intergenic
1144724848 17:17496620-17496642 GGCCGCCGAGCCCGCGGCAGTGG - Intergenic
1145110356 17:20156455-20156477 GGGCGCCGGGGCCGCCGGGCAGG + Intronic
1145110358 17:20156464-20156486 GGCCGCCGGGCAGGCACCGCTGG + Intronic
1145885797 17:28381689-28381711 GGTCGTCGGGCCCGCGGCCCTGG - Exonic
1146322722 17:31859166-31859188 GGCCGCCGGGGCCCAGGCGCAGG - Exonic
1146955975 17:36936594-36936616 GCCCGCCGTCCGCGCCGCGCGGG + Intergenic
1147139579 17:38453778-38453800 GGGCCCCGGGCCCGCGGCTCCGG + Intronic
1147740793 17:42670097-42670119 TGCGGCCGGCCCCGCCGCGCCGG + Exonic
1148183044 17:45620513-45620535 GGCCGCGGGGCCCGGGGAGCGGG + Intergenic
1148265809 17:46225178-46225200 GGCCGCGGGGCCCGGGGAGCGGG - Intronic
1148323679 17:46771635-46771657 GGCCGCCGGGCCCGGGCCGCCGG + Intronic
1148603042 17:48908544-48908566 CGCCCCGGGGCCCGCCGCCCCGG - Exonic
1148652537 17:49260315-49260337 GGCGGCCGGGGCAGCCGCGTGGG - Intergenic
1152087159 17:78227309-78227331 GGCCGCCAGGCTCGCTGGGCAGG + Intergenic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152697590 17:81804587-81804609 GGCCCCGGGCCCCGCCGCCCTGG + Intronic
1152729299 17:81961749-81961771 GGCCACTGGGCCGCCCGCGCTGG - Intronic
1152867956 17:82735522-82735544 GGCCGCCCCTCCCGCCGCCCGGG + Intergenic
1152924393 17:83080539-83080561 GGCCGCGGCGCGCGCTGCGCTGG + Intronic
1203170047 17_GL000205v2_random:140425-140447 GGCCGCTGGGCCAGCAGCGAGGG - Intergenic
1153514493 18:5891385-5891407 GGCCGCCGCGGCCGCCGCCGCGG - Exonic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1154151368 18:11908831-11908853 GGAGGCCGGGCGCGCGGCGCGGG - Exonic
1154501017 18:14998117-14998139 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
1155003003 18:21704666-21704688 GGCCCCCGAGCGCGGCGCGCGGG + Exonic
1155199351 18:23503593-23503615 GGGCGCCGCGCCCGCGGCGGGGG - Exonic
1155218336 18:23662644-23662666 GGCGGCCGGGCCCGCGGGGTCGG - Intronic
1156275720 18:35581489-35581511 TGCCGCCGAGCACGCAGCGCAGG + Intronic
1156275821 18:35581807-35581829 GTCCTCCGGGCCGGCCGCGGCGG - Intronic
1157464207 18:47930538-47930560 GGCCGGCGGCCCGGGCGCGCGGG + Exonic
1157476964 18:48029628-48029650 GGCCGCCGGGCCCGAAGAGCAGG + Exonic
1159045720 18:63367157-63367179 GGCCGCCGGGCAAGGCGCGCAGG + Exonic
1160720732 19:595929-595951 GGCAGCCAGGCCCTCCCCGCAGG - Intronic
1160730583 19:640081-640103 GGCCGCCGGGATCCACGCGCAGG - Exonic
1160763894 19:798590-798612 GGCCCCCGAGCCCGCGGTGCTGG - Intronic
1160858970 19:1229691-1229713 GGCGGCGGGGCCAGGCGCGCGGG + Exonic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1160864327 19:1250352-1250374 GGCCGCCGGGCCCAGCTCGCAGG - Exonic
1160991798 19:1863218-1863240 CGGCTCCGGGTCCGCCGCGCAGG + Exonic
1161248986 19:3270542-3270564 GGGCGCAGGGCGCGCGGCGCGGG + Intronic
1161265236 19:3360587-3360609 GGCCGCGGGTCCCGGCGCGTCGG + Intronic
1161306801 19:3573180-3573202 GGATGCCGGGCCCGGAGCGCTGG - Intronic
1161585188 19:5101980-5102002 GGCCGCCTGCCCCTCCTCGCTGG - Intronic
1162345531 19:10115997-10116019 GGCGGCTGGCCCCGTCGCGCAGG + Exonic
1162751856 19:12834151-12834173 GGCCGCGCGTCCCGCCGCGCTGG + Intronic
1162935331 19:13978999-13979021 CGCCGCCGGAGCCGCCGCCCCGG - Intronic
1162940569 19:14006518-14006540 GGCAGCCGGGCCCGTCACTCCGG + Intronic
1163012250 19:14433474-14433496 GGCCGCCCCTCCCTCCGCGCGGG + Intronic
1163320475 19:16571894-16571916 GGCGGCCGGGCCCGCCGCTTCGG - Intronic
1163462632 19:17448231-17448253 GGCCGCCGCGCTGGCCGCGCTGG - Exonic
1163585467 19:18161280-18161302 GGCCGCGGGGCCCGTGGGGCCGG + Exonic
1163666413 19:18606048-18606070 GGCCGCCTGGCGCGCAGCCCGGG - Intronic
1164051156 19:21586633-21586655 GGCCGCCCGCCCCGGCGCGGAGG - Intergenic
1164146830 19:22517716-22517738 GGCCTCCGGGCCCCGCGCACGGG - Intronic
1164958462 19:32406172-32406194 GGCCGCCGGGGTCGCAGCCCAGG - Exonic
1165591394 19:36972880-36972902 GGCGGCCGGGCCCGCCGCCAGGG - Intronic
1165851394 19:38852058-38852080 GGCGTCCGGGCCGGCCGCGGGGG - Intronic
1165879470 19:39032179-39032201 GGCCGCCCGGGTCCCCGCGCCGG - Exonic
1166528370 19:43527114-43527136 GGGCTCCAGACCCGCCGCGCTGG + Exonic
1166876559 19:45901455-45901477 GGGCGCCGGGCCCGCCGCGGAGG - Exonic
1167149629 19:47701476-47701498 AGCCGCCTGCCCCGCCGTGCCGG - Exonic
1168078509 19:53993012-53993034 GGCCGCCGTGGGCGCCACGCTGG + Exonic
1168718997 19:58544700-58544722 GGGCGCGGGGCCCGCCGCGCAGG - Exonic
925984874 2:9207240-9207262 TGCGGCCGGAGCCGCCGCGCAGG - Intronic
926718622 2:15942699-15942721 GACCGCAGGGCCCGCCGCCGGGG - Exonic
927159218 2:20242386-20242408 GGCCCCCGGACCCGCGGCGCAGG + Intergenic
927881489 2:26692813-26692835 GGCGGCCGGGGCCGAGGCGCGGG + Exonic
930008421 2:46915871-46915893 CGCCGCCGGGCCCCTCCCGCTGG + Intronic
932355840 2:71068025-71068047 GGCTGCCGGGACCGCCTCGAGGG + Intronic
934966859 2:98731127-98731149 GGCCGCCCCGCCCGCCCCGCCGG + Intergenic
934966904 2:98731221-98731243 GGGCGCGGGGCCCGCGGGGCCGG - Intergenic
936600415 2:113889937-113889959 GGCCGCCGGTGCCGACGCCCCGG - Intergenic
937045149 2:118847180-118847202 CGCCGCCCCGGCCGCCGCGCCGG + Exonic
937997083 2:127702129-127702151 GGTCGCCTGGGCCGCGGCGCCGG + Exonic
938290175 2:130144871-130144893 GGCCGCAGAGCCCGCAGCTCAGG - Exonic
938466354 2:131528074-131528096 GGCCGCAGAGCCCGCAGCTCAGG + Exonic
938500188 2:131828306-131828328 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
942459045 2:176157142-176157164 GGCCGCCCAGCCCGGCGCGGGGG - Intronic
944413893 2:199464797-199464819 GGGCGCAGGGCCCGACACGCCGG - Intronic
945045284 2:205776328-205776350 GGCCGCCGGGGGCGCCGTGCTGG + Intronic
945403977 2:209423718-209423740 GCCCGCCTGTCCCGCCGCCCGGG + Intergenic
946185623 2:217978969-217978991 GGCTGCCGGGCCTGCGGGGCGGG + Intronic
946327670 2:218993144-218993166 GGGCGCCGGGCCCGGCGCGGGGG + Exonic
946692479 2:222319730-222319752 GCCCGCCGCGCCCGCCGCCCTGG - Intergenic
947506791 2:230713451-230713473 GGCCCCCGGGCGCCCCACGCCGG - Intronic
947593054 2:231395919-231395941 TGCCCCCGCGCGCGCCGCGCCGG + Intronic
1169075973 20:2759981-2760003 GGCGGCTGGGCCCGCTGCGTGGG - Exonic
1169438079 20:5611037-5611059 GCCCTCCGGCCCCGCCCCGCGGG - Intergenic
1170578417 20:17681388-17681410 GGCCGCAGGGCTCGCGGCGCAGG - Intronic
1171011364 20:21510941-21510963 GGCGGCCGGGCCCGGCTCCCAGG + Intergenic
1171361620 20:24590273-24590295 GGCCCCCAGCCCCGCCGCGCCGG - Intronic
1172367901 20:34363710-34363732 CGCCGCCGGGCCCCGCGCGTAGG - Intronic
1173279842 20:41618255-41618277 GGTCCCCGGCCCCGCCCCGCCGG - Intronic
1173741550 20:45405980-45406002 GGGCGCCGGGCCGGCCGGGCGGG - Intronic
1174386561 20:50191167-50191189 GGCCGCGGGGGGCGCCGCGGGGG - Exonic
1175517315 20:59577665-59577687 GCCCGCCGGGCACGAGGCGCTGG + Intronic
1175715483 20:61252344-61252366 GCCCGCCGCGCTCGCCGCCCCGG - Intergenic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1175847213 20:62065312-62065334 GCCCGCCGGCCCCGCCGCGCTGG - Exonic
1175903088 20:62367544-62367566 CGCCGCCGGGCCCCCAGCCCAGG + Intergenic
1176015600 20:62929569-62929591 GGCCTCAGTGCCCGGCGCGCCGG + Intronic
1176194522 20:63831126-63831148 GGGCGCCGCGGCCGCCGGGCCGG + Intronic
1176201266 20:63861692-63861714 GCCCGCCGCGGCTGCCGCGCAGG - Exonic
1176547349 21:8207651-8207673 GGACGCCGGGCCCGGCCCGGCGG - Intergenic
1176548463 21:8211879-8211901 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1176549598 21:8215348-8215370 GCCCGTCTCGCCCGCCGCGCCGG + Intergenic
1176555254 21:8251860-8251882 GGACGCCGGGCCCGGCCCGGCGG - Intergenic
1176555763 21:8253418-8253440 GGACGTCGGGGCCGCCCCGCGGG + Intergenic
1176556357 21:8256087-8256109 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1176557489 21:8259577-8259599 GCCCGTCTCGCCCGCCGCGCCGG + Intergenic
1176566300 21:8390698-8390720 GGACGCCGGGCCCGGCCCGGCGG - Intergenic
1176567394 21:8394914-8394936 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1176568523 21:8398382-8398404 GCCCGTCTCGCCCGCCGCGCCGG + Intergenic
1176574700 21:8436452-8436474 GGACGTCGGGGCCGCCCCGCGGG + Intergenic
1176575296 21:8439129-8439151 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1176576434 21:8442611-8442633 GCCCGTCTCGCCCGCCGCGCCGG + Intergenic
1176611314 21:8987745-8987767 GGACGTCGGGGCCGCCCCGCGGG + Intergenic
1179833356 21:44012213-44012235 TGCGCCCGGGCCGGCCGCGCGGG - Intergenic
1180005421 21:45018560-45018582 GGCCGCCGAGCCCGCTGCGAGGG + Intergenic
1180064452 21:45405510-45405532 GCCCGCCGGCCTCGCCGCCCTGG + Intronic
1180109853 21:45642829-45642851 GGCCGCAGCGCCCGGCGGGCAGG - Intergenic
1180216202 21:46324915-46324937 GGCGGCCGGGAGCGCCGCGGGGG - Intronic
1180736800 22:18023686-18023708 GGCTGCAGGGCGCGCTGCGCCGG - Intronic
1180801591 22:18634490-18634512 GGCCGCGGGGCGCGGCGCGGGGG - Intergenic
1180852834 22:19030029-19030051 GGCCGCGGGGCGCGGCGCGGGGG - Intergenic
1180960504 22:19760522-19760544 GGCCGACGGGCCCGGCGCACCGG + Intronic
1180981276 22:19879275-19879297 GGCCGCAGGCCCCACCGCCCAGG + Intronic
1181312531 22:21952888-21952910 GGGCGCCGCGGGCGCCGCGCAGG + Intergenic
1181457913 22:23070228-23070250 GCCCGCCGGGCACCACGCGCCGG - Intronic
1181458125 22:23070863-23070885 GGGCGCCGGGGATGCCGCGCGGG + Intronic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1181652917 22:24270832-24270854 GGCCGCCCGGCCTCCCTCGCGGG - Exonic
1181934474 22:26429183-26429205 GGTCCCCGGCCCCGCCCCGCAGG + Intergenic
1182189246 22:28442355-28442377 GGCCTCTCGGCCCGCCGCCCCGG + Intronic
1182237006 22:28883820-28883842 GGCCGCGGGGGCGGCGGCGCAGG - Exonic
1182296072 22:29311739-29311761 TGGCTCCGGGCCCGCCGGGCAGG - Intronic
1182485355 22:30635739-30635761 CACCGCCGCGCCCGCCGTGCCGG + Exonic
1183258187 22:36776524-36776546 GGCGGCCTGGCCCACTGCGCAGG - Intergenic
1183368587 22:37419897-37419919 GGCGGCGGGGCGGGCCGCGCTGG - Intronic
1183665701 22:39244588-39244610 AGCAGCCGTGCCCGCCGCCCGGG - Exonic
1184164720 22:42720606-42720628 GGTGGCCGGGACCGCCGCGCGGG + Intronic
1184663693 22:45976860-45976882 GGCCGCCCGAGCCGCAGCGCGGG - Exonic
1184759403 22:46536464-46536486 CCCCGCCGGGCCCGTCGCGCCGG + Exonic
1185255193 22:49827739-49827761 GCCGGCCGGGCCCCCCGAGCCGG - Intergenic
1185409580 22:50674767-50674789 GGGCGCCGGGCGCGCCCGGCGGG - Intergenic
1203252222 22_KI270733v1_random:123936-123958 GGACGCCGGGCCCGGCCCGGCGG - Intergenic
1203252748 22_KI270733v1_random:125503-125525 GGACGTCGGGGCCGCCCCGCGGG + Intergenic
1203253347 22_KI270733v1_random:128184-128206 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1203254484 22_KI270733v1_random:131669-131691 GCCCGTCTCGCCCGCCGCGCCGG + Intergenic
1203260804 22_KI270733v1_random:170589-170611 GGACGTCGGGGCCGCCCCGCGGG + Intergenic
1203261401 22_KI270733v1_random:173262-173284 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1203262540 22_KI270733v1_random:176748-176770 GCCCGTCTCGCCCGCCGCGCCGG + Intergenic
950045519 3:9946658-9946680 GGCCGCGGAGGCCGCAGCGCTGG + Exonic
950583907 3:13879827-13879849 GGCCGCCGGGGCCGCGGGCCGGG + Exonic
950683962 3:14603135-14603157 GGCCGCCAGGCGCTCCGCTCCGG + Intergenic
951907938 3:27722061-27722083 GGCCGCGGGGGCCCCTGCGCTGG + Exonic
952382592 3:32816878-32816900 GGCTCCCGAGCTCGCCGCGCGGG + Intergenic
954632918 3:52056616-52056638 GGCCGCGGGGGCCGGCGCCCGGG + Intergenic
954778891 3:53045392-53045414 GCGCGGCGGGCCCGGCGCGCCGG + Intronic
956675041 3:71725331-71725353 GGCCGCCGCGCCCCCCGCCGGGG - Exonic
961202578 3:125056163-125056185 CGCCTCCGGGCCCGCCGCGCGGG - Intergenic
961212619 3:125137587-125137609 GCCCGGCAGGCCCGCCTCGCAGG + Intronic
961446122 3:126982654-126982676 GGCGCCCGGGCTCCCCGCGCAGG + Intergenic
962263103 3:133927499-133927521 AGCCGCCGGGCCCTCCGAGTAGG + Intergenic
963904470 3:150762693-150762715 GTCCGCGGTGCCCGCCGCGGCGG - Exonic
965962052 3:174440899-174440921 AGGCGCCGGGGCCGCCGCTCGGG + Intronic
966362931 3:179148914-179148936 GGCCGCCGCCCCGGCCGCGGTGG + Intronic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
966982730 3:185153037-185153059 GGGCGCGGCGCGCGCCGCGCCGG - Intergenic
968025985 3:195442888-195442910 GGCCGCGGGAGCGGCCGCGCTGG + Exonic
968081754 3:195851139-195851161 GGAGGCCGGGCCCTTCGCGCCGG - Intergenic
968511359 4:997300-997322 GGAGGCCGGGCCCGCTGGGCTGG - Intronic
968603214 4:1520182-1520204 CGCCGCCGGGCCCGCCCTGATGG + Intergenic
968697692 4:2041028-2041050 GGCCGCCCCGCTCGCCGTGCAGG - Intronic
968730519 4:2267352-2267374 GGCTACCGGGTCGGCCGCGCTGG + Intergenic
968764728 4:2462460-2462482 CGCCGCCGGGGCCGCCGCAAGGG - Exonic
968775458 4:2537046-2537068 GGCCGCCAGGCCCGCGGCCTGGG - Intronic
968819952 4:2843343-2843365 GGCCCCCGGGCCCGGCCTGCGGG - Intergenic
969344698 4:6563520-6563542 GGCGCCCGGCCCCGCCGCTCCGG - Intronic
969436543 4:7192433-7192455 TGCCGGCCGGCCCGCCGCCCAGG - Intergenic
969584128 4:8082229-8082251 GGCCCCAGGGCCCGACGTGCTGG + Intronic
969912891 4:10461505-10461527 GGCTGCACCGCCCGCCGCGCGGG - Intergenic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
976595581 4:86892252-86892274 GGCCGCCGGCGCCGGCTCGCGGG - Intronic
977941960 4:102868958-102868980 CGCCGCCCCGCCCGCCGCCCAGG + Exonic
978515074 4:109560550-109560572 GGCTGCCGGGCTCCGCGCGCCGG + Intronic
980362724 4:131762536-131762558 GATCGCCGGGGCCGCAGCGCGGG + Intergenic
981315587 4:143336956-143336978 GGCCGGCGCGCCCGCGGCCCCGG + Exonic
982921255 4:161277343-161277365 GGCCGGCCGGCCCGCCCTGCCGG + Intergenic
984667881 4:182448394-182448416 TACCGCCGGGCCCGCCTGGCAGG + Intronic
985629852 5:1008744-1008766 GGCCGCCGGGGGCGCTGCGGGGG + Intergenic
985783327 5:1881978-1882000 GGACTCCGGGCCCGCCGCCTCGG - Exonic
985844595 5:2334902-2334924 GCCTGCCGGGCCCGCTGCCCAGG + Intergenic
986402839 5:7396191-7396213 GGCAGCCGGGCCGGCCGAGGCGG + Exonic
987050469 5:14143764-14143786 GTCCTCCGGCCCCGCCGCGGCGG + Exonic
988595300 5:32585521-32585543 AGACGCCGGCCCCGCCGCGCTGG - Exonic
992104206 5:73436818-73436840 GGCCGCGGGGCCCGGCGGGGCGG - Intergenic
992671906 5:79069677-79069699 GGCCGCGGGGCCGGCGGGGCGGG + Intronic
992828023 5:80569277-80569299 GGCCGGCGGGCGAGCGGCGCAGG - Intronic
994497778 5:100535478-100535500 AGCCGCCAGGCCCGCCACGCTGG - Exonic
997248235 5:132369735-132369757 GGCCGCAAGGCGCGCCCCGCTGG - Exonic
997297687 5:132777799-132777821 GGCCGCCTGGCCGGACGCGCGGG - Intronic
997454079 5:134004795-134004817 GCGCGCCGGGCCGGGCGCGCAGG - Intronic
997476870 5:134147686-134147708 GGCTGCCGGGCCAGGCGCGGTGG + Exonic
997704111 5:135930633-135930655 GGCGGCCGGGCCCGGGCCGCGGG - Intronic
997953124 5:138257784-138257806 GGCCGCCGAGCCCCACGCGCAGG - Exonic
999300353 5:150486549-150486571 GTCGGCCGGGCCCCGCGCGCGGG + Intronic
999809565 5:155114930-155114952 GGCCGCCGCGCCCCCGGCTCTGG + Intergenic
1001070286 5:168579508-168579530 GGCCGCCGGCCTCGCCGCTCCGG + Exonic
1002211127 5:177600070-177600092 GTCCGCCGGGTCCGCCGCTCCGG - Intergenic
1002512747 5:179733355-179733377 GGCCCCGGCGCCCGCCGCCCCGG + Exonic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1003897024 6:10617279-10617301 GCCGGCCGGCCCCGCCGCCCGGG - Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004908507 6:20259664-20259686 GGCCGGCCGGCCCGCCCCGCCGG + Intergenic
1005473926 6:26188949-26188971 CGCCGCCTGGCTCGCCGCGGCGG - Exonic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1007423475 6:41733561-41733583 GGCCGCGGGGCCCGGAGAGCTGG - Intronic
1007435310 6:41806315-41806337 GGCAGCCGGGCCCGCGTCGCGGG + Exonic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1008941153 6:57046956-57046978 GGCCGCCCGGCCCCCCGCACGGG + Intronic
1008945342 6:57090454-57090476 GGCCGCCCGGCCCCCCGCACGGG + Intronic
1013575659 6:111482406-111482428 GGCCACCTGGCCCGCCGTCCGGG + Intronic
1014272317 6:119348993-119349015 CGCCGCCGAGCCCCCCGCCCAGG + Exonic
1016923215 6:149317064-149317086 GGCGGCCGGCGGCGCCGCGCGGG - Intronic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017662439 6:156687486-156687508 CGCCGCCGCGCTCGCCGAGCCGG - Intergenic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019444847 7:1066029-1066051 GGCATCCGTGCCGGCCGCGCAGG - Intronic
1019620088 7:1987653-1987675 AGCCGCCGGGCCCGCACGGCAGG + Intronic
1019681873 7:2355029-2355051 GCCCGCGGGGCCCGGCGCTCCGG + Exonic
1020395809 7:7716658-7716680 AGCCACCGCGCCGGCCGCGCCGG - Intronic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021653593 7:22854139-22854161 GGCCTCCGGGCCCCGCGGGCGGG + Intergenic
1021717016 7:23469836-23469858 GGGCCCCAGGCCCGGCGCGCTGG - Intronic
1021845285 7:24757420-24757442 GGCAGCCGCGCCCCCTGCGCTGG + Intronic
1022106198 7:27199640-27199662 GCCCGCCGGGCCCGCCGGGCCGG + Exonic
1022943202 7:35258413-35258435 GGCTGCGGGGCCTGGCGCGCGGG - Intergenic
1023064818 7:36366955-36366977 GCCCGCGGAGCCCGCCGCCCCGG - Intronic
1023881748 7:44324978-44325000 GGCCCCCGGGCCTGGAGCGCCGG - Intronic
1024499820 7:50093151-50093173 CGCCGCCTGCCCCGCCGCGCTGG + Exonic
1024741766 7:52362749-52362771 GCCAGCCGGCCCCGCCGCCCAGG + Intergenic
1024919720 7:54544767-54544789 GGCCGAGGGGGCCGGCGCGCAGG + Exonic
1027061860 7:75092665-75092687 GGCGGCCGGGAGCCCCGCGCGGG - Exonic
1027421206 7:78019644-78019666 GGCCGGCAGGCCCGCCTCGGAGG - Exonic
1029708344 7:102286857-102286879 GGCGGAGGGGCGCGCCGCGCTGG + Intronic
1030033493 7:105389027-105389049 GGGCGCTGGGCGCGCGGCGCTGG - Intronic
1032074497 7:128830172-128830194 GGCCCCCGGTGCCGCCGCGCTGG - Intergenic
1034347648 7:150397197-150397219 TGCAGCCGGGGCCGCCGCGGGGG + Exonic
1034441046 7:151086336-151086358 GGGCGCCCGGGCCGGCGCGCAGG + Intronic
1034470436 7:151251841-151251863 GGCGGCCGAGCCCGTCCCGCAGG - Intronic
1034578845 7:152025634-152025656 GGCCGCCTGTCACGCGGCGCCGG + Intergenic
1034951295 7:155298359-155298381 GGCCGCCAGCCCCGCGGCGCTGG - Exonic
1035050783 7:155998074-155998096 GGGCGCAGGGCCCGCTGTGCAGG + Intergenic
1035159804 7:156942548-156942570 GGCCGCTGGGCCATCTGCGCTGG - Intergenic
1035265588 7:157688965-157688987 GGCCGCAGCACCCTCCGCGCCGG - Intronic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035580745 8:737965-737987 GCCCGCCGGGGCCGGAGCGCTGG + Intronic
1036641871 8:10589885-10589907 TGCCGTCGGGCCTGCCGGGCAGG + Intergenic
1036710906 8:11077936-11077958 GGCCGCCGGGCTGGCCCTGCTGG + Intronic
1036797971 8:11769686-11769708 GGCCGCATGGGCCGCCGAGCCGG + Intronic
1036801358 8:11794901-11794923 GGCGGCCGGCCCCGCCGGCCAGG + Intergenic
1037981546 8:23258046-23258068 GCCCGCCGGGCATGCCGAGCAGG + Exonic
1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG + Intronic
1038883587 8:31640024-31640046 GGCCCCCGGGCCCAGCGCCCCGG + Intronic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1041355249 8:56993444-56993466 CGCCGCCAGGCTCGCCGCCCAGG + Exonic
1041690080 8:60679350-60679372 GTCCGCCGGGCCGGCGGCGGCGG + Intronic
1042246396 8:66712791-66712813 CGGCTCCGCGCCCGCCGCGCCGG + Intronic
1042271816 8:66962614-66962636 CGCCCCCGAGCCCGCCCCGCCGG - Intergenic
1045118742 8:99012978-99013000 GGCTGCTGGGGCCGCTGCGCCGG - Intergenic
1046871285 8:119208353-119208375 GGGCTCCGGGCGCGCCGCGCGGG - Exonic
1047961712 8:130016210-130016232 GGCCGCCGGGCCGGGCGCTGCGG - Intronic
1048833446 8:138497327-138497349 GGCCGCCGGGCGGCCCGCCCCGG - Intergenic
1048980799 8:139702635-139702657 GGCGGCTGAGCGCGCCGCGCCGG - Intronic
1049145930 8:141001093-141001115 GGGCGCCGGGCGCGGGGCGCGGG - Intronic
1049409175 8:142464843-142464865 GGCCGCCCGCCTCGCCGCCCAGG - Exonic
1049554704 8:143276035-143276057 GCCCGCCGGCCGCTCCGCGCTGG - Exonic
1049554706 8:143276047-143276069 GGCCGGCGGGCCAGCCGCCTGGG + Exonic
1049601030 8:143507758-143507780 AGCCGCCGGGCCCGCCAGGAGGG + Exonic
1049788487 8:144462531-144462553 GGCCGCCGGGCAGGCGGCGGCGG - Intronic
1056163620 9:83921553-83921575 CGCCTCCAAGCCCGCCGCGCAGG + Intergenic
1057208135 9:93185211-93185233 CGCCCCCGCGCCCGCAGCGCTGG + Exonic
1057361219 9:94374991-94375013 GGCCCGCGAGCCCGCCGCTCCGG + Intronic
1057488563 9:95505899-95505921 GGCGGCCGCGGCCGCCGCGCTGG - Intronic
1057596153 9:96417756-96417778 GGCCGCGGGGGCCGCCGCCTCGG - Exonic
1057662144 9:97013173-97013195 GGCCCGCGAGCCCGCCGCTCCGG - Intronic
1058508851 9:105694551-105694573 GGCCGCCCGCTCCTCCGCGCCGG - Exonic
1059102194 9:111482817-111482839 GGCCGCCCCGCCCGCCGCCGGGG - Intronic
1059470945 9:114504736-114504758 GGCCGCCGAGCCCAGCGAGCCGG + Exonic
1060283476 9:122228849-122228871 AGGCGCCGGCCCCGCCGCCCCGG + Intronic
1060296529 9:122347148-122347170 GGCCGCCCGGGCCGCTCCGCGGG - Intergenic
1060555382 9:124504986-124505008 GGCCCCCGGCCCCGGCGCGGCGG - Intronic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1061190771 9:129081348-129081370 GGCCGGCGCGCGCGCCGCGCAGG + Intronic
1061487986 9:130929927-130929949 GGGCGCCGTGCCCGGCGCGTGGG + Exonic
1061559680 9:131394354-131394376 GGCCCCCGGGCCCCCGGCGGCGG - Intronic
1061720184 9:132546594-132546616 GGCTGCCGAGACCCCCGCGCTGG + Intronic
1062341329 9:136095047-136095069 TGCCGCAGTGCCGGCCGCGCGGG - Intronic
1062406623 9:136399872-136399894 TGCAGCCGGGGCCGCCCCGCCGG + Intergenic
1062499520 9:136846271-136846293 GGGCTCCGGGGCCCCCGCGCTGG + Exonic
1062584150 9:137241521-137241543 GGCCGCCGGGCCCCCTCCGCGGG + Intronic
1062696345 9:137877996-137878018 CCCCGCCGGCCCCGCCGCCCCGG - Exonic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1203436086 Un_GL000195v1:138266-138288 GGCCGCTGGGCCAGCAGCGAGGG + Intergenic
1203469151 Un_GL000220v1:108654-108676 GGACGTCGGGGCCGCCCCGCGGG + Intergenic
1203469747 Un_GL000220v1:111331-111353 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1203470885 Un_GL000220v1:114813-114835 GCCCGTCTCGCCCGCCGCGCCGG + Intergenic
1203476972 Un_GL000220v1:152626-152648 GGACGTCGGGGCCGCCCCGCGGG + Intergenic
1203477568 Un_GL000220v1:155303-155325 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1203478706 Un_GL000220v1:158785-158807 GCCCGTCTCGCCCGCCGCGCCGG + Intergenic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1187332657 X:18354734-18354756 GGCACGCGGGCCGGCCGCGCGGG - Intergenic
1187464410 X:19515027-19515049 GGCCGCCGGCCGCGCCGCCCTGG + Exonic
1191830113 X:65407206-65407228 AGCGGCCGGGCCGGCCGTGCAGG + Intronic
1192237621 X:69305990-69306012 GGCCGCCCCGCCTCCCGCGCTGG - Intergenic
1197754304 X:129983707-129983729 GGCCGCCGGGCCGGGCGCGGCGG + Intronic
1198424187 X:136497904-136497926 GGCCGCCTGGCCAGCCTCGCGGG + Intronic
1199772571 X:150983977-150983999 GGCCACCGGGCGCTCCGCGACGG - Intronic
1200068758 X:153517741-153517763 GGCGGCCTGGCCGGCGGCGCGGG - Intronic
1200147697 X:153935071-153935093 GGCCGCCGGGCCCGTCCTCCCGG + Exonic
1200277838 X:154751096-154751118 GGGCGCTGGGCCCGCCCCGCCGG - Intronic
1201291192 Y:12421583-12421605 GCCCTCCGGGCCCCCAGCGCCGG - Intergenic