ID: 912996366

View in Genome Browser
Species Human (GRCh38)
Location 1:114536039-114536061
Sequence CCGTGGCTGCATGTAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912996366_912996368 -8 Left 912996366 1:114536039-114536061 CCAGCAGCTACATGCAGCCACGG 0: 1
1: 0
2: 1
3: 14
4: 159
Right 912996368 1:114536054-114536076 AGCCACGGCTGACACATTCCTGG 0: 1
1: 2
2: 1
3: 7
4: 92
912996366_912996371 10 Left 912996366 1:114536039-114536061 CCAGCAGCTACATGCAGCCACGG 0: 1
1: 0
2: 1
3: 14
4: 159
Right 912996371 1:114536072-114536094 CCTGGAGCACATGTGCCACCTGG 0: 1
1: 1
2: 3
3: 19
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912996366 Original CRISPR CCGTGGCTGCATGTAGCTGC TGG (reversed) Intergenic
900003283 1:27303-27325 CAGTGGCTGCATGTGCCTGGTGG - Intergenic
900023002 1:197825-197847 CAGTGGCTGCATGTGCCTGGTGG - Intergenic
900152171 1:1183436-1183458 CCGTGGCTGCACGAGGCTGAAGG + Intronic
901679439 1:10904636-10904658 CAATGCCTGCATGTAGCTCCCGG - Intergenic
905486535 1:38301203-38301225 CCTGGGATGCATGTGGCTGCTGG + Intergenic
905531047 1:38678975-38678997 CAGTGACTGCATGTAGTTGGAGG - Intergenic
909013615 1:70360433-70360455 ACGTGGCTGCTTTTACCTGCTGG - Intronic
910163465 1:84298707-84298729 CCGTGGGTGCAACGAGCTGCAGG - Intronic
912342794 1:108934230-108934252 CCATGGCTGCATGAAGATGCTGG + Exonic
912996366 1:114536039-114536061 CCGTGGCTGCATGTAGCTGCTGG - Intergenic
916051343 1:161038869-161038891 CCATGGCTGGAGGTACCTGCGGG - Exonic
917876753 1:179293463-179293485 GCGTGGTAGCATGGAGCTGCAGG - Intergenic
918015874 1:180632148-180632170 CCGCCGCCGCCTGTAGCTGCTGG + Exonic
918204210 1:182294801-182294823 AGGTGGCTGCAGGTGGCTGCTGG + Intergenic
919840949 1:201609127-201609149 CCTGGGCTGCATGTGACTGCTGG + Intergenic
919936246 1:202252574-202252596 CCCTGGCAGCAGGTAGTTGCTGG - Intronic
921013292 1:211163058-211163080 CCCTGGCTCCATGTCGCTCCTGG + Intergenic
921680999 1:218030845-218030867 CAGGGGCTTCATGGAGCTGCAGG + Intergenic
923556875 1:235008011-235008033 CTGTGGCTTCTGGTAGCTGCAGG + Intergenic
1071027830 10:81137264-81137286 TGGGGACTGCATGTAGCTGCTGG + Intergenic
1074185636 10:111097728-111097750 TCGTGGATGCAGGCAGCTGCAGG + Intergenic
1074676820 10:115860638-115860660 CTGTGGCTGCATGCAGTTGGAGG - Intronic
1075102703 10:119517476-119517498 CTGTGGCTTCATGGAGCTGGTGG - Intronic
1078026379 11:7699652-7699674 GCCTGGCTGCATGTAGATCCTGG + Intronic
1078744830 11:14102508-14102530 CAGTAGCTACATGTAGCTGGTGG + Intronic
1081915072 11:46725556-46725578 TAGTGGCTGCCTGGAGCTGCTGG - Intronic
1084287430 11:68141243-68141265 CTGTGGCTGCAGGGGGCTGCAGG + Intergenic
1091376700 12:29363-29385 CAGTGGCTGCATGTGCCTGGTGG - Intergenic
1091821372 12:3477959-3477981 CAGTAGCTGGATGTAACTGCTGG + Intronic
1092527911 12:9320772-9320794 GAGTGGCTGCATGTACCTGGTGG - Intergenic
1092539355 12:9411006-9411028 GAGTGGCTGCATGTACCTGGTGG + Intergenic
1092578910 12:9818991-9819013 CCCTGGCTCCATGTTGCTCCCGG - Intergenic
1094500154 12:31013843-31013865 GAGTGGCTGCATGTACCTGGCGG - Intergenic
1095141258 12:38665684-38665706 GCCTGGCTGCATGTAGCTGCTGG - Intronic
1100156248 12:91804016-91804038 CCTTGGCTCCATGTTGCTCCAGG - Intergenic
1106356313 13:28986877-28986899 CAGTGGCTGCATATACCTGGTGG + Intronic
1107175543 13:37394674-37394696 GCGTGGCTGCATTTTGCTGGGGG - Intergenic
1107644945 13:42484437-42484459 ACATGGCTGCAGGTAGCTGGTGG + Intergenic
1108608261 13:52061887-52061909 CAGTGGCGGCATGAAGCTCCAGG - Intronic
1112501225 13:99944842-99944864 CTGTGGCTGCAAGGGGCTGCAGG + Intergenic
1114540413 14:23452591-23452613 CAGTGGCTGCCTGAAGCTGGTGG + Intergenic
1114756633 14:25267351-25267373 CGGTGGCGGGATGTAGGTGCTGG + Intergenic
1116084121 14:40213517-40213539 TGGTGGCTGCAGGTTGCTGCTGG + Intergenic
1116932429 14:50703238-50703260 CCTTGGCTCCATGTTGCTCCTGG + Intergenic
1117820465 14:59644302-59644324 CCCTGGCTCCATGTTGCTCCTGG - Intronic
1119010893 14:70987294-70987316 CCGTTGCTACATGTAGCTAGTGG - Intronic
1119671744 14:76525291-76525313 CACTGGCTGCACGTGGCTGCAGG + Intergenic
1121318765 14:92978582-92978604 CTGAGGCTGCATGGAGCAGCAGG - Intronic
1125724567 15:41861725-41861747 CTGTGCCTGCCTGTAGCTCCAGG + Exonic
1125883775 15:43213730-43213752 ACGTGGTTGAATGTAGATGCAGG - Intronic
1126118886 15:45233509-45233531 CATTGGCTGCATGAAGCTGCAGG - Intergenic
1128272286 15:66321086-66321108 CAGAGGCTGCATAAAGCTGCAGG + Intronic
1128509939 15:68307235-68307257 CCCTGGCTGCATGTCCCAGCAGG - Intronic
1128985660 15:72219031-72219053 CCATGGCTGCGTGCAGCTGCTGG + Exonic
1129458378 15:75687746-75687768 CCGTGGCTGGATCCAGCTGCAGG - Exonic
1132450221 15:101963635-101963657 CAGTGGCTGCATGTGCCTGGTGG + Intergenic
1132533638 16:466606-466628 CTGTGGCTGCCTGTGGTTGCCGG + Intronic
1132870731 16:2114697-2114719 CCGTGGCTGCAAGCAGCCGCAGG + Exonic
1133800008 16:9077547-9077569 CAGTAGCTGCAAGTTGCTGCCGG - Intergenic
1134521798 16:14922207-14922229 CCGTGGCTGCAAGCAGCCGCAGG - Intronic
1134637868 16:15806407-15806429 TCGTGGCTGCCAGGAGCTGCGGG + Intronic
1134709468 16:16320858-16320880 CCGTGGCTGCAAGCAGCCGCAGG - Intergenic
1134716681 16:16360887-16360909 CCGTGGCTGCAAGCAGCCGCAGG - Intergenic
1134950135 16:18347787-18347809 CCGTGGCTGCAAGCAGCCGCAGG + Intergenic
1134958069 16:18391272-18391294 CCGTGGCTGCAAGCAGCCGCAGG + Intergenic
1139421871 16:66854008-66854030 CCGTGGCAGCAGGTGGCTGGAGG - Exonic
1141570747 16:84932203-84932225 CAGTGGCTGCAGGGAGCTGCGGG + Intergenic
1142212082 16:88813130-88813152 CGGAGGCTGCATGCGGCTGCTGG + Intergenic
1142673428 17:1498222-1498244 CTGTGGCTGCCAGTAGTTGCTGG - Intronic
1144033134 17:11340330-11340352 CTGTGGTTGCATTTAGCTGTGGG + Intronic
1146457587 17:33019473-33019495 CCGTGGGTGCATGAACCTGTAGG + Intronic
1146807691 17:35878422-35878444 CTGTGGCTGCTTGCAGCTGGAGG + Intronic
1147884246 17:43674111-43674133 CTGTGCCTGCATGCAGCTGTGGG - Intergenic
1156219936 18:35041229-35041251 CGGTGCCTGCCTGGAGCTGCTGG + Intronic
1159292714 18:66442668-66442690 CAGTGGATGCTTGAAGCTGCAGG - Intergenic
1160007090 18:75075557-75075579 CCCTGGCTGCAGGGAGCCGCTGG - Intergenic
1160635035 19:68911-68933 CAGTGGCTGCATGTGCCTGGTGG - Intergenic
1161678959 19:5669443-5669465 CCGTGGCTCCAGCTTGCTGCTGG - Intergenic
1163284560 19:16338357-16338379 CCCTGGCTGCCTGGAGATGCTGG + Intergenic
1165031701 19:33002367-33002389 TCATGGCTGCGTGTAGCTGTTGG + Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167405591 19:49305666-49305688 ACATGGCTGCATTTAGCTGGAGG - Intronic
1168061059 19:53892502-53892524 CCCTGGCTTCAGGTTGCTGCAGG - Exonic
925675653 2:6358507-6358529 CCGGGGCAGCATGTGACTGCCGG + Intergenic
926005903 2:9373360-9373382 CCTTGGGTGCATGTGGCTCCTGG - Intronic
928181435 2:29071397-29071419 CCGGGGCTGCCTGTAGAGGCTGG + Exonic
930020420 2:46998490-46998512 CCAAGGCTCCATGTACCTGCAGG + Intronic
930530146 2:52579859-52579881 CCATGGCTGAATGTATCTCCAGG - Intergenic
931154087 2:59608070-59608092 CTGAGGCTGCATGTAGTAGCAGG - Intergenic
932594527 2:73085929-73085951 GAGTGACTGAATGTAGCTGCAGG - Intronic
935651050 2:105382368-105382390 CCGAGGCTGCAGGTAGCAGGTGG + Intronic
936077409 2:109410418-109410440 CCCTGGGTGCACGGAGCTGCAGG - Intronic
936566445 2:113586116-113586138 CAGTGGCTGCATGTGCCTGGTGG + Intergenic
937606477 2:123807394-123807416 CCTTGGCTCCATGTTGCTCCTGG - Intergenic
937996102 2:127696119-127696141 CAGAGGCTACATGTGGCTGCTGG + Intergenic
944932772 2:204536731-204536753 CCGTGATTGCAGGAAGCTGCAGG - Intergenic
948904515 2:240972266-240972288 CCATGGCTCCCTGTGGCTGCAGG - Intronic
1170581016 20:17699686-17699708 CCGTGGCAGCAAGTGGCAGCAGG + Intronic
1171186302 20:23126513-23126535 CAGTGGCTGCCTGTGGCTGGTGG + Intergenic
1173590542 20:44221464-44221486 CAGTGGCTGGAGGGAGCTGCAGG + Intergenic
1174550647 20:51359158-51359180 ACTTGGCCACATGTAGCTGCTGG - Intergenic
1175999003 20:62823882-62823904 CAGGGGCTGCATGGAGCAGCCGG - Intronic
1181494381 22:23279758-23279780 CCATGGCTCCATGGAGATGCTGG - Intronic
1184838837 22:47040613-47040635 CCCTGGGTGCATGAGGCTGCTGG + Intronic
950005882 3:9690642-9690664 CCGTGGCTGAAGGGCGCTGCAGG + Intronic
950073516 3:10171026-10171048 GCGTGGCTGTCTGTGGCTGCGGG - Intronic
950923496 3:16717548-16717570 CCTTGGCTCCATGTTGCTCCTGG + Intergenic
953785463 3:45907798-45907820 CCGTGGCTGCTTGTTGCTGAGGG - Intronic
954019240 3:47724490-47724512 CCTTGGCTGCACGTAGCTCATGG - Intronic
954704471 3:52471857-52471879 CCGTGACGGCATACAGCTGCAGG - Exonic
959719323 3:109469676-109469698 CTGAGGCTGCATGTAGCAGGGGG - Intergenic
966941530 3:184750913-184750935 CCCTGGCTGCATTTAGCCACGGG - Intergenic
968631076 4:1651824-1651846 CCGGGGCTGCATGGATCTGAGGG + Intronic
969364946 4:6688964-6688986 ACGTGGCTGCACGTAGCCGAGGG + Intergenic
978748541 4:112222464-112222486 CCGGGGCTGCACGCGGCTGCAGG + Intergenic
980712843 4:136592118-136592140 GTGTAGCTGCATGAAGCTGCTGG - Intergenic
982645929 4:158025898-158025920 CCCTGGCTTCATGTGGCTCCTGG - Intergenic
983000454 4:162408456-162408478 GCCTGGCTGCATGCAGTTGCTGG - Intergenic
983684156 4:170388396-170388418 CCCTGGCTCCACATAGCTGCTGG + Intergenic
986449546 5:7850920-7850942 CCGCGGCGGGATGTAGCTGAAGG + Exonic
986794690 5:11197987-11198009 TCGTGGCTTCATGTATCTGTTGG + Intronic
987204343 5:15609746-15609768 CCATGGCTACATCAAGCTGCCGG - Intronic
987886276 5:23817063-23817085 GCCAGGCTGCATGTAGGTGCTGG + Intergenic
990359741 5:55006839-55006861 CCTTGGCTCCATGTTGCTCCTGG - Intronic
990931425 5:61095800-61095822 CCCTGGCTCCATGTCGCTCCAGG + Intronic
992196098 5:74340436-74340458 TCCTGGCTGCATGTAAGTGCAGG + Intergenic
997128509 5:131253074-131253096 CAGAGTCTGCATGTGGCTGCAGG + Intronic
997977653 5:138449726-138449748 CAGAGGCTGGATGGAGCTGCTGG - Intergenic
999087873 5:148909486-148909508 CAGTGGTTGCCTGTGGCTGCAGG + Intergenic
1002999694 6:2319516-2319538 CCATGGCAGCATCTAGCTGGAGG + Intergenic
1003422630 6:5972456-5972478 CCATGGCTGCGTGCAGCTGCTGG - Intergenic
1005186562 6:23168681-23168703 CAGTGAATGTATGTAGCTGCCGG - Intergenic
1007916914 6:45569576-45569598 TCGAGGCTGCATGCAGCTGGAGG + Intronic
1015488772 6:133801032-133801054 CCCTGGCTCCATGTTGCTCCTGG + Intergenic
1015539985 6:134304166-134304188 CCTTGGCTGCATTCAGCTGGTGG - Intronic
1018370367 6:163162698-163162720 CCTTGGCTGCATGTACCACCTGG - Intronic
1019265167 7:111081-111103 CCGTGTCTGCAGGTGGGTGCTGG - Intergenic
1019310820 7:359790-359812 CCGTGGCTGCCTGCAGGTGGGGG + Intergenic
1022076302 7:26974178-26974200 CCGTGGCTCCATGTTGCTCTTGG + Intronic
1024165019 7:46722444-46722466 CCTTGGCTCCATGTTGCTTCTGG - Intronic
1025769947 7:64495158-64495180 CAGTGGCAGCATGAAGCTGGTGG + Intergenic
1032643709 7:133797621-133797643 CGGTGGCTGCATGTGTCTGGTGG + Intronic
1036208767 8:6825276-6825298 CCGAGGCTGGCTGCAGCTGCAGG - Exonic
1036454103 8:8893099-8893121 GCGGCGCGGCATGTAGCTGCGGG - Exonic
1041022422 8:53651409-53651431 CTCTGGCTGCATGTGGCTACTGG - Intergenic
1041047267 8:53899582-53899604 CAGTGGCTGCCTGGGGCTGCTGG - Intronic
1043324498 8:79033706-79033728 TCTTGGCTCCATGTAGCTCCTGG - Intergenic
1043503837 8:80883457-80883479 CCATAGCTGCATGTGGCTGGTGG - Intergenic
1047374860 8:124286357-124286379 TTGTGGCTGCATTTAGCTACAGG + Intergenic
1047690306 8:127345446-127345468 CAGTGGCTGCATGTGGCTAATGG - Intergenic
1049496383 8:142936128-142936150 ACGTGACTGCCTGTAGCAGCAGG + Intergenic
1049886088 9:27416-27438 CAGTGGCTGCATGTGCCTGGTGG - Intergenic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1052029332 9:23610596-23610618 AGGTGGGGGCATGTAGCTGCTGG - Intergenic
1052817075 9:33110037-33110059 CCCTGCCTGCATGTCACTGCTGG - Intronic
1052846441 9:33340399-33340421 CCGAGGCTGCATGCAGCAGGGGG + Intronic
1060112068 9:120913570-120913592 CCACGGCTGCCTGCAGCTGCAGG + Exonic
1060152445 9:121297451-121297473 CCGTGGCTGCCTGAGGCTGGAGG - Intronic
1061879267 9:133560611-133560633 CCATGGCTGCACGGACCTGCTGG - Intronic
1186092853 X:6068346-6068368 CCCTGCCTGCATGTGGGTGCAGG - Intronic
1190286663 X:48966095-48966117 CCGTGGCAGCATGCAGGAGCTGG - Exonic
1191123340 X:56927866-56927888 CCTTGGCTTCATGTTGCTTCTGG + Intergenic
1191889644 X:65926847-65926869 CCTTGGCTCCATGTCACTGCAGG + Intergenic
1192080837 X:68046495-68046517 AAGTGGCTGCATGTAACAGCAGG + Exonic
1193051859 X:77110714-77110736 CCTTGGCTCCATGTCGCTCCTGG - Intergenic
1194389590 X:93299921-93299943 CCGAGGCTGCATGAAGCAGAGGG - Intergenic
1197632512 X:128877806-128877828 CTGTGCCTGCATGTAACTGCTGG + Intergenic
1199248819 X:145636977-145636999 CCCTGGCTCCATGTTGCTCCTGG - Intergenic
1200697103 Y:6370709-6370731 CTGTGGCTGCATGATTCTGCAGG + Intergenic
1201037010 Y:9793990-9794012 CTGTGGCTGCATGATTCTGCAGG - Intergenic
1202129143 Y:21594398-21594420 CTGAGGCTGCATGTTTCTGCAGG - Intergenic
1202270222 Y:23065064-23065086 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202423216 Y:24698809-24698831 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG + Intergenic