ID: 912996877

View in Genome Browser
Species Human (GRCh38)
Location 1:114539306-114539328
Sequence GCTCCAGACTTAGGTACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912996877_912996881 -1 Left 912996877 1:114539306-114539328 CCTGATGTACCTAAGTCTGGAGC No data
Right 912996881 1:114539328-114539350 CCCTTCCCGGATCCTTTATCTGG No data
912996877_912996887 29 Left 912996877 1:114539306-114539328 CCTGATGTACCTAAGTCTGGAGC No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996877_912996884 4 Left 912996877 1:114539306-114539328 CCTGATGTACCTAAGTCTGGAGC No data
Right 912996884 1:114539333-114539355 CCCGGATCCTTTATCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912996877 Original CRISPR GCTCCAGACTTAGGTACATC AGG (reversed) Intergenic
No off target data available for this crispr