ID: 912996878

View in Genome Browser
Species Human (GRCh38)
Location 1:114539315-114539337
Sequence CCGGGAAGGGCTCCAGACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912996878_912996887 20 Left 912996878 1:114539315-114539337 CCTAAGTCTGGAGCCCTTCCCGG No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996878_912996890 26 Left 912996878 1:114539315-114539337 CCTAAGTCTGGAGCCCTTCCCGG No data
Right 912996890 1:114539364-114539386 CAGTTATGCCCAGCTGGAAAAGG No data
912996878_912996884 -5 Left 912996878 1:114539315-114539337 CCTAAGTCTGGAGCCCTTCCCGG No data
Right 912996884 1:114539333-114539355 CCCGGATCCTTTATCTGGAGAGG No data
912996878_912996891 27 Left 912996878 1:114539315-114539337 CCTAAGTCTGGAGCCCTTCCCGG No data
Right 912996891 1:114539365-114539387 AGTTATGCCCAGCTGGAAAAGGG No data
912996878_912996881 -10 Left 912996878 1:114539315-114539337 CCTAAGTCTGGAGCCCTTCCCGG No data
Right 912996881 1:114539328-114539350 CCCTTCCCGGATCCTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912996878 Original CRISPR CCGGGAAGGGCTCCAGACTT AGG (reversed) Intergenic
No off target data available for this crispr