ID: 912996880

View in Genome Browser
Species Human (GRCh38)
Location 1:114539328-114539350
Sequence CCAGATAAAGGATCCGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912996880_912996890 13 Left 912996880 1:114539328-114539350 CCCTTCCCGGATCCTTTATCTGG No data
Right 912996890 1:114539364-114539386 CAGTTATGCCCAGCTGGAAAAGG No data
912996880_912996891 14 Left 912996880 1:114539328-114539350 CCCTTCCCGGATCCTTTATCTGG No data
Right 912996891 1:114539365-114539387 AGTTATGCCCAGCTGGAAAAGGG No data
912996880_912996887 7 Left 912996880 1:114539328-114539350 CCCTTCCCGGATCCTTTATCTGG No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912996880 Original CRISPR CCAGATAAAGGATCCGGGAA GGG (reversed) Intergenic
No off target data available for this crispr