ID: 912996882

View in Genome Browser
Species Human (GRCh38)
Location 1:114539329-114539351
Sequence TCCAGATAAAGGATCCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912996882_912996890 12 Left 912996882 1:114539329-114539351 CCTTCCCGGATCCTTTATCTGGA No data
Right 912996890 1:114539364-114539386 CAGTTATGCCCAGCTGGAAAAGG No data
912996882_912996887 6 Left 912996882 1:114539329-114539351 CCTTCCCGGATCCTTTATCTGGA No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996882_912996891 13 Left 912996882 1:114539329-114539351 CCTTCCCGGATCCTTTATCTGGA No data
Right 912996891 1:114539365-114539387 AGTTATGCCCAGCTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912996882 Original CRISPR TCCAGATAAAGGATCCGGGA AGG (reversed) Intergenic
No off target data available for this crispr