ID: 912996883

View in Genome Browser
Species Human (GRCh38)
Location 1:114539333-114539355
Sequence CCTCTCCAGATAAAGGATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912996883_912996891 9 Left 912996883 1:114539333-114539355 CCCGGATCCTTTATCTGGAGAGG No data
Right 912996891 1:114539365-114539387 AGTTATGCCCAGCTGGAAAAGGG No data
912996883_912996890 8 Left 912996883 1:114539333-114539355 CCCGGATCCTTTATCTGGAGAGG No data
Right 912996890 1:114539364-114539386 CAGTTATGCCCAGCTGGAAAAGG No data
912996883_912996887 2 Left 912996883 1:114539333-114539355 CCCGGATCCTTTATCTGGAGAGG No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912996883 Original CRISPR CCTCTCCAGATAAAGGATCC GGG (reversed) Intergenic
No off target data available for this crispr