ID: 912996887

View in Genome Browser
Species Human (GRCh38)
Location 1:114539358-114539380
Sequence GTTGCCCAGTTATGCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912996886_912996887 -5 Left 912996886 1:114539340-114539362 CCTTTATCTGGAGAGGTTGTTGC No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996878_912996887 20 Left 912996878 1:114539315-114539337 CCTAAGTCTGGAGCCCTTCCCGG No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996882_912996887 6 Left 912996882 1:114539329-114539351 CCTTCCCGGATCCTTTATCTGGA No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996880_912996887 7 Left 912996880 1:114539328-114539350 CCCTTCCCGGATCCTTTATCTGG No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996877_912996887 29 Left 912996877 1:114539306-114539328 CCTGATGTACCTAAGTCTGGAGC No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996883_912996887 2 Left 912996883 1:114539333-114539355 CCCGGATCCTTTATCTGGAGAGG No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data
912996885_912996887 1 Left 912996885 1:114539334-114539356 CCGGATCCTTTATCTGGAGAGGT No data
Right 912996887 1:114539358-114539380 GTTGCCCAGTTATGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912996887 Original CRISPR GTTGCCCAGTTATGCCCAGC TGG Intergenic
No off target data available for this crispr