ID: 912997645

View in Genome Browser
Species Human (GRCh38)
Location 1:114547273-114547295
Sequence GAGTGGGGAAAGAGGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912997633_912997645 13 Left 912997633 1:114547237-114547259 CCCTTATAATCTCCTTCCAGAAG No data
Right 912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG No data
912997634_912997645 12 Left 912997634 1:114547238-114547260 CCTTATAATCTCCTTCCAGAAGG No data
Right 912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG No data
912997632_912997645 23 Left 912997632 1:114547227-114547249 CCAGCAAAGACCCTTATAATCTC No data
Right 912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG No data
912997637_912997645 1 Left 912997637 1:114547249-114547271 CCTTCCAGAAGGAGGCTGCTAGC No data
Right 912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG No data
912997638_912997645 -3 Left 912997638 1:114547253-114547275 CCAGAAGGAGGCTGCTAGCAGAG No data
Right 912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912997645 Original CRISPR GAGTGGGGAAAGAGGGCTGA GGG Intergenic
No off target data available for this crispr