ID: 912999548

View in Genome Browser
Species Human (GRCh38)
Location 1:114565903-114565925
Sequence GAGCCATCACACCCAACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912999545_912999548 4 Left 912999545 1:114565876-114565898 CCTCCCAAAGTGCTGGGATTTAG No data
Right 912999548 1:114565903-114565925 GAGCCATCACACCCAACCTGAGG No data
912999541_912999548 13 Left 912999541 1:114565867-114565889 CCACCTTGGCCTCCCAAAGTGCT No data
Right 912999548 1:114565903-114565925 GAGCCATCACACCCAACCTGAGG No data
912999543_912999548 10 Left 912999543 1:114565870-114565892 CCTTGGCCTCCCAAAGTGCTGGG No data
Right 912999548 1:114565903-114565925 GAGCCATCACACCCAACCTGAGG No data
912999546_912999548 1 Left 912999546 1:114565879-114565901 CCCAAAGTGCTGGGATTTAGACA No data
Right 912999548 1:114565903-114565925 GAGCCATCACACCCAACCTGAGG No data
912999539_912999548 17 Left 912999539 1:114565863-114565885 CCTCCCACCTTGGCCTCCCAAAG No data
Right 912999548 1:114565903-114565925 GAGCCATCACACCCAACCTGAGG No data
912999547_912999548 0 Left 912999547 1:114565880-114565902 CCAAAGTGCTGGGATTTAGACAT No data
Right 912999548 1:114565903-114565925 GAGCCATCACACCCAACCTGAGG No data
912999540_912999548 14 Left 912999540 1:114565866-114565888 CCCACCTTGGCCTCCCAAAGTGC No data
Right 912999548 1:114565903-114565925 GAGCCATCACACCCAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912999548 Original CRISPR GAGCCATCACACCCAACCTG AGG Intergenic