ID: 913007808

View in Genome Browser
Species Human (GRCh38)
Location 1:114651959-114651981
Sequence GAGCTTCAGCAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913007805_913007808 -7 Left 913007805 1:114651943-114651965 CCAGCATGGGATGTTAGAGCTTC No data
Right 913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 324
913007804_913007808 -6 Left 913007804 1:114651942-114651964 CCCAGCATGGGATGTTAGAGCTT No data
Right 913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 324
913007801_913007808 8 Left 913007801 1:114651928-114651950 CCACAGAGGGGTAGCCCAGCATG 0: 1
1: 0
2: 0
3: 20
4: 154
Right 913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 324
913007800_913007808 9 Left 913007800 1:114651927-114651949 CCCACAGAGGGGTAGCCCAGCAT No data
Right 913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913007808 Original CRISPR GAGCTTCAGCAGAATGAGGA GGG Intronic
900560317 1:3301948-3301970 TAGCTCCAGCAGAATTTGGAGGG + Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
901234492 1:7660705-7660727 GAGCTTCAGCCAAAGGAGGAAGG + Intronic
903298065 1:22358459-22358481 GAGCTTAAGCAAAAAGGGGAAGG - Intergenic
903520958 1:23949428-23949450 GAGCTCCAGCCGAAGGAGAAGGG - Intergenic
903743881 1:25573923-25573945 GAGCGTCAGCTCCATGAGGATGG - Intergenic
903943165 1:26945495-26945517 GAGCTTCAGCAGGAAGGTGAGGG + Intronic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904540170 1:31227516-31227538 CAGTTACAGCAGAATGAGGTGGG + Intronic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
905410846 1:37766848-37766870 GAGCGTGAGGAGAATGAAGATGG - Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907526166 1:55055348-55055370 GAGCCTCAGAGGAATGAGAAGGG - Intronic
907869157 1:58427216-58427238 GAGATGCAGTAGAGTGAGGAGGG + Intronic
909340745 1:74528282-74528304 GAGCCTGAGCAGGGTGAGGAGGG + Intronic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
909758592 1:79260596-79260618 GAGGTAGACCAGAATGAGGAAGG + Intergenic
911031093 1:93489120-93489142 TTTCTTCAGCAGCATGAGGAAGG + Intronic
911117875 1:94265157-94265179 GAGCTTCAACAAAATGAGTCAGG - Intronic
912490087 1:110057998-110058020 GAGCCTCAGCAAAATGAGCTGGG + Intronic
913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG + Intronic
913318754 1:117574377-117574399 AAGCTGCAGGAGAAGGAGGATGG - Intergenic
913525136 1:119684145-119684167 GAATTTCTGCAGAATGAGTAGGG - Intronic
916150803 1:161787488-161787510 GAGTCACAGCAGAGTGAGGAGGG - Intronic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917410306 1:174753297-174753319 GAGATTCAGAAGAATGATAAGGG - Intronic
917526343 1:175791702-175791724 GAGCTTCTGTACAATGAGGAGGG + Intergenic
917854972 1:179092404-179092426 CAGGTCCAGCAGAATGAGGGAGG - Intronic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
918873534 1:190008592-190008614 GAGCTTCAGAAGACCGAGGCAGG - Intergenic
920498387 1:206471136-206471158 GAGCTACACCGGAAAGAGGAGGG - Exonic
922261775 1:223950269-223950291 GAGCCTGAGCAGATTGAGGTGGG - Intergenic
922496669 1:226062787-226062809 GAGCTCCAGCCGAAGGAGAAGGG + Intronic
922912400 1:229228594-229228616 CAGCTTCAGGAGACTGAGGGGGG + Intergenic
923298309 1:232616410-232616432 GAGCTCCAGAAGAATGAGAGTGG + Intergenic
924111389 1:240703148-240703170 GGGGTTCAGGAGAATGAAGATGG + Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068369864 10:56098418-56098440 GAACTTAAGCAGAATGAAAATGG + Intergenic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1074507617 10:114085582-114085604 GAGATTCAGCCGAGTGAGGATGG - Intergenic
1075228229 10:120648966-120648988 GGGCTTTAGCAGATTCAGGAAGG - Intergenic
1077343168 11:2035040-2035062 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1079431848 11:20397647-20397669 GACCTCCAGGAGGATGAGGATGG + Exonic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1083313050 11:61795512-61795534 GATGTGCTGCAGAATGAGGAGGG + Exonic
1083372411 11:62192719-62192741 CAGCTTCTGCAGAACCAGGAAGG + Intronic
1083995393 11:66269121-66269143 GGGCTTCAGGAGAAAGAGAAGGG - Intronic
1084549687 11:69833913-69833935 GCGCTTCGGGAGGATGAGGAGGG + Intergenic
1086527300 11:87742836-87742858 GAGCTTATCCAAAATGAGGAGGG + Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088579538 11:111301051-111301073 GAGTTCCAGAAGAATGAGGAGGG - Intronic
1088689177 11:112310859-112310881 GGGCTTGAACAGACTGAGGAGGG + Intergenic
1089233851 11:117005796-117005818 ATGCTTCAGCAGAAAGAGGCAGG + Intronic
1089380906 11:118030752-118030774 GAGCCAAAGCAGGATGAGGAGGG + Intergenic
1089535165 11:119156544-119156566 GAGCTGCAGCAGAAAGAGAAGGG - Exonic
1090003792 11:122983128-122983150 GAGCTTGAGAGGAAGGAGGAAGG + Intergenic
1090174625 11:124637593-124637615 GAGCCACTGCAGAATGAAGAAGG + Intronic
1091131842 11:133153130-133153152 GAGCTGCTGCAGAATGTGGGAGG - Intronic
1202826154 11_KI270721v1_random:90229-90251 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1091611083 12:2010326-2010348 GAGCCAGAGCAGAATGAGAAGGG + Intronic
1092168096 12:6355271-6355293 GACCTCCATCAGCATGAGGAAGG - Exonic
1092395377 12:8121508-8121530 GAGCTTTAGCAGGGTGAGAAGGG + Intergenic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1096113089 12:49040467-49040489 AAGCTTCAGCAGACAGAGGCCGG + Exonic
1099426977 12:82535415-82535437 GTGGTCCTGCAGAATGAGGATGG - Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1102504440 12:113374783-113374805 GAGCTGCAGCAGGCTGAGGAGGG - Exonic
1102671759 12:114625391-114625413 GAGCTCCAGCAGAATCTGCAGGG + Intergenic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1104515292 12:129419484-129419506 AAACTTTAGCAGAAGGAGGATGG + Intronic
1104570432 12:129920308-129920330 AGGCTTCAGGAGAATGAGCAGGG - Intergenic
1105242419 13:18620114-18620136 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1105503722 13:20992610-20992632 GGGCTTCAGCAGAAGAAGAAAGG + Intronic
1106090743 13:26591124-26591146 GACCTGCAGTAGAATGAGGAGGG + Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1107314732 13:39119355-39119377 GAGCTCCAGCAGCATCAGGTCGG - Intergenic
1110002445 13:70221542-70221564 AAACTTCAGTAGAAAGAGGACGG - Intergenic
1110692023 13:78442068-78442090 CTGCTCCAGCTGAATGAGGATGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111934581 13:94546315-94546337 GGGCTTCAGCAGAGTCAGGAAGG - Intergenic
1112972470 13:105277304-105277326 GAGCTTCAGGAGGCTGAGGCAGG + Intergenic
1114536164 14:23424272-23424294 GAGCTTCAGAAGTATGGGGAGGG + Intronic
1114638784 14:24205231-24205253 GAGTTTCACCAGACTGTGGAAGG + Intronic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115027517 14:28761637-28761659 GATCTTCAGCAAAATGTGCATGG - Intergenic
1116950565 14:50874914-50874936 TAGCTTCAGAGGAAAGAGGAAGG - Intronic
1117008529 14:51446933-51446955 GAGCTTGGGCAGGATGGGGATGG + Intergenic
1117894503 14:60467824-60467846 GAGTTTCAGAAGAATGAAAAAGG + Intronic
1118906807 14:70029253-70029275 GGGTGTCAGCAGAATGAGGCTGG + Intronic
1119258863 14:73224816-73224838 GATCTTGATGAGAATGAGGACGG + Intergenic
1120833469 14:89018947-89018969 GAGCTTTGGGAGACTGAGGAGGG - Intergenic
1122029234 14:98900518-98900540 GAGCTTCAGAGCCATGAGGATGG - Intergenic
1123488880 15:20764478-20764500 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1123545379 15:21333565-21333587 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1124181490 15:27479859-27479881 GAGCTCCAGCAGAGAGGGGATGG + Intronic
1124789494 15:32714238-32714260 GATGTTCACCAGAATGAGGAGGG - Intergenic
1124859273 15:33422530-33422552 GAGCTTCAGAAGTGTGGGGAAGG + Intronic
1127135677 15:55920720-55920742 GTGCCTCAGCAGAATAAAGACGG + Intronic
1127234232 15:57030636-57030658 GAGTTTCAGCAGAAAGACAATGG - Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1130960391 15:88655068-88655090 AAGCTTCAGGACACTGAGGAGGG - Intronic
1131168854 15:90162201-90162223 GAGCTACAGCAGAAGTTGGAAGG - Intronic
1202953724 15_KI270727v1_random:60836-60858 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1132894228 16:2220314-2220336 GGGCTTAAGCAGAAGCAGGAAGG - Intergenic
1133624962 16:7562596-7562618 GAGCCCCAGCAGAATGAGATGGG + Intronic
1136319042 16:29470684-29470706 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1136433613 16:30210028-30210050 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1139810880 16:69616185-69616207 GAGCCTGAGCTGAATAAGGAGGG - Intronic
1141007218 16:80363626-80363648 GTGCTTCACCAGACTGAGGCGGG - Intergenic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1143002341 17:3802559-3802581 GAGGTTCAACAGAAGTAGGATGG - Intergenic
1143425853 17:6836970-6836992 AAGCTACAAAAGAATGAGGAAGG + Intergenic
1143462914 17:7115231-7115253 AAGCTTCAGCAGGAGGAGGAAGG + Intronic
1144814357 17:18023183-18023205 GCACTTCAGGAGAATGAGGTGGG + Intronic
1145771004 17:27493071-27493093 CATCATCAGCAGAATGATGAAGG - Intronic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1148343217 17:46885946-46885968 GAGCTTCTGCAAGATGAGGTGGG + Intronic
1149104454 17:52944572-52944594 GAGCTTCGGCAGCATGGGGATGG + Intergenic
1150803967 17:68304264-68304286 GAGCCTCAGCACAAGGAGGGTGG - Intronic
1150909356 17:69371795-69371817 TGGCCTCAGCAGAATGAGCAAGG + Intergenic
1151649003 17:75454148-75454170 AAGCTTCAGAAAAATGAAGAAGG + Intronic
1151783528 17:76263703-76263725 GAGTTTAAGCAGATTGGGGAAGG - Intergenic
1151849823 17:76683690-76683712 GTGCTTGAGAAGAATGAGAAGGG + Intronic
1153301148 18:3593208-3593230 GAGTTCCTGCAGAGTGAGGATGG - Intronic
1153568862 18:6448106-6448128 CTGCTTCAGCAGAGTGTGGAAGG + Intergenic
1153928499 18:9857225-9857247 AAGCTTCAGCATAAAGATGAAGG - Intronic
1154446530 18:14439764-14439786 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1155521011 18:26669139-26669161 GAGCTTCATGAGAATGCAGAGGG - Intergenic
1155798262 18:30067693-30067715 GGCCTTCAGCTGAAAGAGGAAGG - Intergenic
1155838211 18:30613608-30613630 GAGCTGCAGCAGCATGTGAAGGG + Intergenic
1156525584 18:37764785-37764807 GAACTGGAGCAGAAGGAGGAGGG - Intergenic
1156620229 18:38842904-38842926 AACCTTCAGCAGAAAGAGGATGG - Intergenic
1158914462 18:62108089-62108111 GAATTTCATCAAAATGAGGAAGG + Intronic
1159394050 18:67833142-67833164 GAGCTTTAGAAAAAAGAGGAAGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1163713006 19:18857954-18857976 GAGCGTCAGCAGAGTGAAAAAGG - Intronic
1165558237 19:36655097-36655119 GATGTTCAGCAGACTGAGGTGGG - Intronic
1166097332 19:40549129-40549151 GAGCCACAGCAGGATCAGGAGGG + Intronic
1167960018 19:53097915-53097937 GAGCTTCAGCAGCAGGAGGATGG - Intronic
925023297 2:588312-588334 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
925234616 2:2267018-2267040 GTGCTTCAGCACAGGGAGGATGG + Intronic
925996436 2:9297280-9297302 GAGCTGCAACAGAATGACGGAGG - Exonic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926383555 2:12314585-12314607 GAGATGCAGCAGCAGGAGGAGGG - Intergenic
926688294 2:15715471-15715493 GCACTTCAGGAGATTGAGGAGGG - Intronic
928251631 2:29686198-29686220 GAGGTTCAGGAGCCTGAGGAGGG - Intronic
931402436 2:61943513-61943535 GAGGTCCAGCACCATGAGGAGGG + Intronic
931836613 2:66105595-66105617 GAGCCCCAGCAGAATGAGAGAGG - Intergenic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
932647103 2:73513689-73513711 GAGCCCAAGCAGAATGAGGTAGG - Intronic
934181309 2:89623733-89623755 GATCTACAGCAGTCTGAGGAAGG + Intergenic
934895860 2:98118998-98119020 GAGCTTCACCCGAGAGAGGAGGG + Intronic
935195058 2:100808810-100808832 GAGTTTCAGCAGACCGAGAAGGG + Intergenic
935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG + Intergenic
935493074 2:103744630-103744652 GAGCTTCACCACAATGTGGCAGG + Intergenic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936975554 2:118218002-118218024 GCACTTCAGGAGACTGAGGAGGG + Intergenic
937681290 2:124647583-124647605 GAGCTCCACCAGAGTTAGGATGG - Intronic
937942889 2:127301786-127301808 GAGCTTCAGAAAGATGAGGGAGG - Exonic
938483430 2:131680469-131680491 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
941345421 2:164362456-164362478 GAGGTTAAGCAGAATGTTGAAGG - Intergenic
941827480 2:169916587-169916609 GAGCCAAGGCAGAATGAGGAGGG - Intronic
941889838 2:170568610-170568632 GAGCCTCTGCAGAATGTGGTGGG - Intronic
942319047 2:174719860-174719882 GAGCTCCAGCCGAAGGAGAAGGG + Intergenic
943009291 2:182427008-182427030 GAGCTTGACCAGCATGTGGAAGG - Intronic
943515450 2:188880329-188880351 GAGTTTCATCAGAATAAGCAAGG + Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944823218 2:203452713-203452735 GCACTTCAGCAGACTGAGGCAGG + Intronic
944882388 2:204026682-204026704 AAGCCACAGGAGAATGAGGAAGG + Intergenic
945663109 2:212710270-212710292 GGGCCTCAAAAGAATGAGGAAGG + Intergenic
945743743 2:213695199-213695221 GAGCTTGAGTAGAATGAGAAAGG - Intronic
946327045 2:218990133-218990155 GACCTTCAGAAAGATGAGGATGG + Intergenic
946863402 2:224021523-224021545 GAGTTTCAGTCAAATGAGGAAGG + Intronic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
947612539 2:231532857-231532879 GGGACTCAGCAGGATGAGGAGGG - Intergenic
1170141776 20:13132074-13132096 GATTTTCAGCAGAAAGGGGATGG - Intronic
1171496060 20:25556168-25556190 GATATTCAGCAGACTGAGGTGGG + Intronic
1172315723 20:33952674-33952696 GAGCCACAGCAGGATGGGGAGGG + Intergenic
1172513733 20:35518091-35518113 GAGTTTGAGAAGAATGAGGTGGG - Exonic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1175517852 20:59580083-59580105 GAGATTCATCAGAATGGGGCTGG + Intronic
1176449452 21:6850079-6850101 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1176827622 21:13715103-13715125 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1176949249 21:15024677-15024699 GAGCTCAAGCAGGATGAGGTTGG + Intronic
1177191731 21:17859471-17859493 GAGCATCATCAGAAAGAGAAAGG - Intergenic
1178070511 21:28960822-28960844 GAACTTCAGGAGGAGGAGGAGGG - Intronic
1179026169 21:37680578-37680600 GGGCTTCAGCAGATTGAATAAGG - Intronic
1179570668 21:42276910-42276932 AAGCTTCAGGAGAAGGATGAAGG + Exonic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1180140124 21:45888173-45888195 GAGCTGCAGGAGCAGGAGGAGGG - Intronic
1180756584 22:18166135-18166157 GAGGTTCTCCAGACTGAGGACGG - Intronic
1181075185 22:20371298-20371320 GAGGTTCTCCAGACTGAGGACGG + Intronic
1182070674 22:27461585-27461607 GAGCTCCTGGAGAATGAGGTTGG + Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183191711 22:36325789-36325811 CAGCTCCTGCAGAATGGGGACGG - Intronic
1183804690 22:40198470-40198492 GAGCCTGAGTAGGATGAGGAGGG + Intronic
1184314362 22:43672703-43672725 CACCCTCAGGAGAATGAGGATGG + Intronic
1185324379 22:50218534-50218556 GAGCTTCAGCTGCAGCAGGAAGG + Exonic
950273283 3:11636854-11636876 GAGCTACAGATGAATGAGAAGGG + Intronic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
951595205 3:24311361-24311383 GGGCTTAAGCAAAATTAGGAGGG + Intronic
953132555 3:40154252-40154274 GAGCTGCAGGAGAAGGAGAAAGG - Intronic
953813590 3:46134764-46134786 GAGCTTCAGTGGAATGGGGATGG - Intergenic
954273509 3:49527408-49527430 CAGCTACAGGAGAATGAGGCAGG + Intronic
955421579 3:58743588-58743610 GAGCTTCAGAAGAGTTTGGATGG + Intronic
955789229 3:62571434-62571456 GAGCTTTTGGAGAAGGAGGAAGG - Intronic
960959404 3:123058746-123058768 CAGCTTCAGGAGAATGAAGCTGG - Intergenic
962682698 3:137816072-137816094 GAGCTTCTCCAAAATGGGGAAGG + Intergenic
969476985 4:7427427-7427449 GAGCTTCAGCAGTGGGAGGATGG + Intronic
969694049 4:8725000-8725022 GAGCTTCAGCATGAGGAGGGTGG - Intergenic
970223209 4:13831468-13831490 CAGCTGCAGGAGAATGAGTAAGG - Intergenic
971366295 4:25979667-25979689 GACCTGCAGGAGAATAAGGAAGG - Intergenic
972485484 4:39536193-39536215 CAGCTAGAGGAGAATGAGGAGGG - Intergenic
972790661 4:42368412-42368434 GAGCTGCTGCAGAAAGATGATGG + Intergenic
973143043 4:46792712-46792734 GAGAATCAGAAGAATTAGGATGG - Intronic
973993685 4:56435982-56436004 GAGCTTCCGCAGAGTGGGGAGGG + Intronic
974794737 4:66733920-66733942 AGGCTTCAGCAAAATGTGGATGG + Intergenic
976782894 4:88781172-88781194 GAGCTTCATGACAATCAGGACGG - Exonic
976850519 4:89540204-89540226 GAGCTTCAGGAAAGGGAGGATGG - Intergenic
977703109 4:100042980-100043002 CAGCTTCAGAAGAATGTGGGTGG + Intergenic
979742404 4:124167922-124167944 GAGGTCCTGCACAATGAGGAGGG - Intergenic
980706246 4:136499459-136499481 GAGCTTGAGCAGTATGGGAAGGG - Intergenic
980852584 4:138401051-138401073 GACCTTCAGCAGAATAGGCATGG + Intergenic
980986341 4:139698580-139698602 GAGCTCCAGCCGAAGGAGAAGGG - Intronic
980996843 4:139787134-139787156 GCGCTGCTGCAGAACGAGGAAGG - Intronic
982280542 4:153680054-153680076 GGGCTCCAGAAGAATGAGAATGG - Intergenic
982283008 4:153705102-153705124 GGGCTCCAGAAGAATGAGAATGG - Exonic
982743468 4:159081953-159081975 GAGTTTCAGCAGAGTCTGGATGG - Intergenic
982918266 4:161242100-161242122 GTGCTGCAGGAGAATGATGATGG - Intergenic
983515734 4:168654714-168654736 GAGCTGCAGCAGAGCGGGGAGGG - Intronic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985995284 5:3594323-3594345 GGACTTCAGCAGCATCAGGAGGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986346508 5:6840358-6840380 GAGATTCAGCACATTCAGGAGGG - Intergenic
989508953 5:42260929-42260951 GGTCTCCAGCAAAATGAGGAAGG + Intergenic
990297177 5:54414099-54414121 GAGCTTGAGAAGAATGTGTAAGG - Intergenic
991430614 5:66541061-66541083 GAGATTTAGCAGAACGAGGCTGG - Intergenic
992204391 5:74416390-74416412 GAACATTAGCAGAATGACGAAGG - Intergenic
992320018 5:75604621-75604643 GAGCTTTGGGAGACTGAGGAAGG - Intergenic
994401472 5:99285649-99285671 GTGCTTTATCAGAATGATGATGG - Intergenic
995758269 5:115536058-115536080 CAGTTTCAGGGGAATGAGGAGGG + Intronic
996220310 5:120924131-120924153 GAGTTGCAGCAGGGTGAGGAAGG - Intergenic
997146827 5:131443410-131443432 GACCCTCAGCAGAGTGATGATGG - Intronic
997981805 5:138472315-138472337 GGGCTTCAGGAATATGAGGAAGG + Intergenic
1000212767 5:159122942-159122964 GATCTTCAGGAGACTGAGGCAGG + Intergenic
1000401751 5:160836085-160836107 TAGATTCAAAAGAATGAGGAGGG + Intronic
1001771824 5:174302582-174302604 AAGCTTAAGCAGAATGCTGAGGG - Intergenic
1002105909 5:176879392-176879414 TATCTTCTGCCGAATGAGGAAGG - Exonic
1003480206 6:6524327-6524349 GAGCTTCAGGAGGCTGAGGCGGG + Intergenic
1004396431 6:15249244-15249266 GTGCTTCAGCAGGATGTGGCCGG + Intronic
1006133351 6:31881625-31881647 CAGCTTCAGCAGAGTGGGAAGGG + Intronic
1007574468 6:42916157-42916179 GGGCTTCGGCAGACTGAGGAGGG - Intronic
1007707410 6:43799298-43799320 CATCTTCAGGAGAATGGGGATGG - Intergenic
1009310168 6:62140101-62140123 GAGCTTAAGCAAAATATGGAAGG - Intronic
1010649266 6:78432235-78432257 CAGCTTCAGCATAGTGAGAAAGG + Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011716029 6:90105998-90106020 GAGCTTCAGAAGAGGGAAGAAGG + Intronic
1013799141 6:113920498-113920520 GAGGTTCAGAAGAGTGAGGCTGG - Intergenic
1014174193 6:118314059-118314081 GAGCACCAGCCCAATGAGGATGG - Exonic
1015516748 6:134090019-134090041 AAGCTCCAGCAGAAAGGGGAAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015519465 6:134115664-134115686 GAGATTCAGAAGAATGACCACGG + Intergenic
1016292270 6:142538670-142538692 AAGCTTCAGAAGCTTGAGGACGG + Intergenic
1016514987 6:144883662-144883684 GACCTTCAGGAGAATCAGGAAGG + Intergenic
1016527693 6:145021167-145021189 GAGCATCTGCAGAAAGTGGAGGG - Intergenic
1017356268 6:153512804-153512826 GAACTTCTGCAGAATGAAGTGGG - Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018085739 6:160300054-160300076 GAGCTTCAGCAGATTTTGGCAGG + Intergenic
1019144762 6:169969619-169969641 GGGCTTCAGCAGAAAGACGCAGG - Intergenic
1021034471 7:15780576-15780598 GTGCTTCAGGAGACTGAGGTGGG - Intergenic
1021629950 7:22635057-22635079 GAGCTTTAGAGGAATGAGGCAGG + Intergenic
1021630195 7:22637473-22637495 GCACTTCAGCAGACTGAGGCAGG - Intergenic
1022089321 7:27097213-27097235 GACGTGCAGCAGAATGAGGAAGG - Intergenic
1022127894 7:27375620-27375642 GCCATTCAGCAGAATGAGCAAGG - Intergenic
1022522573 7:31017580-31017602 GAACTCCAGCAGAGGGAGGAAGG + Intergenic
1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG + Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023753398 7:43393168-43393190 GAGCTTCAACAGAGAGAGGGGGG + Intronic
1023878714 7:44306825-44306847 GAGTGTGAGTAGAATGAGGAGGG + Intronic
1023945338 7:44798071-44798093 GAGCTTCAGGGAAATGAGAAAGG + Intronic
1024215417 7:47244323-47244345 CAGCTTCTCCAGAATGAGAATGG - Intergenic
1024502654 7:50129162-50129184 GAACTTCAGCAGAAAGAAAATGG + Intronic
1024955523 7:54915282-54915304 CAGCTTAAGCAAAATGAGCAAGG - Intergenic
1025959868 7:66210471-66210493 GAGCTTTTAAAGAATGAGGATGG + Intronic
1030844620 7:114393638-114393660 GAGCCTCAGCAGCATGAAGAAGG + Intronic
1031392362 7:121231433-121231455 GAGCTTAAGGAGAATGATGAAGG + Intronic
1031783860 7:126004062-126004084 GAGCTTCAGCAGAAGTATGTGGG + Intergenic
1031970486 7:128061487-128061509 GTCCCACAGCAGAATGAGGAAGG + Intronic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032689589 7:134269938-134269960 GTTCTTCAGCAAATTGAGGAAGG - Intergenic
1033932318 7:146539280-146539302 GGGTTTCTGAAGAATGAGGAAGG + Intronic
1034379384 7:150677138-150677160 GATCTTAAGCTGCATGAGGAGGG - Intergenic
1034437117 7:151068013-151068035 GAGCTCCAGGAGACTGCGGAAGG - Exonic
1034940810 7:155229000-155229022 CAGCTTGAGCAGAATGAGACTGG - Intergenic
1035117462 7:156536650-156536672 GACCTGCTGCAGGATGAGGAAGG + Intergenic
1035818136 8:2562407-2562429 GAGCTTGAGCAAAACCAGGAAGG + Intergenic
1037292523 8:17366439-17366461 CAGCATCAGCAGAATGGGAAGGG + Intronic
1037292659 8:17367836-17367858 TAGCATCAGCAGAATGCGAAGGG - Intronic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1038943323 8:32329984-32330006 TAGCTTCAGGAGACTGAGGTGGG - Intronic
1038954606 8:32453825-32453847 GAGCTGCAGCTGACTGGGGATGG - Intronic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1041383935 8:57279422-57279444 CAGCTTCAGGAGAGTGAGAAAGG + Intergenic
1042529721 8:69802664-69802686 GAGCCTCAGCAGGAAGAGGCTGG - Intronic
1044708964 8:95036947-95036969 ATGCTCCAGCAGAATGGGGAAGG - Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045425420 8:102061181-102061203 GACCATCTGCAGAATGAGCAGGG + Intronic
1047513809 8:125536291-125536313 GAGCTTAAGCTGAAGGAGCAGGG + Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048517971 8:135127624-135127646 GAGCTTCACCAGCATGTGCATGG - Intergenic
1049656319 8:143799992-143800014 GAGTTTCAGAAAAATGGGGAAGG + Intronic
1049820314 8:144629452-144629474 GAGCTGCAGCAGGCTGGGGAAGG + Intergenic
1051182108 9:14422463-14422485 GGGCTTTGGCAGAATGAGAAAGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052417932 9:28201912-28201934 GAACTTCATGAGAAAGAGGAAGG - Intronic
1053116166 9:35504709-35504731 GCACTTCAGGAGAATGAGGCAGG - Intronic
1054825808 9:69572425-69572447 GAGCTTCAGGTGACTGGGGAAGG - Intronic
1055733630 9:79304881-79304903 GAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1055738474 9:79359594-79359616 GACCTCCAGAAGAAGGAGGAGGG + Intergenic
1056336102 9:85570837-85570859 GAGCCTAAGCAGGGTGAGGAAGG + Intronic
1056374213 9:85991133-85991155 GAGCCTAAGTAGGATGAGGAGGG + Intronic
1057138392 9:92711196-92711218 CACCTTCAGGAGAATGGGGAGGG - Intergenic
1057669660 9:97076901-97076923 GAGCTCCAGAAGAGAGAGGAGGG - Intergenic
1057953109 9:99385745-99385767 GTGCTCCAACAGAATGAGCAGGG + Intergenic
1058794250 9:108482985-108483007 GTACTTCAGGAAAATGAGGAAGG + Intergenic
1058976377 9:110128701-110128723 GAGCTTTAACAGCCTGAGGATGG + Intronic
1059283996 9:113157353-113157375 GAGCTGCAGCAGAATGGCTAGGG + Intronic
1059562899 9:115352461-115352483 GTGCATCAGAAGAATGAGTAGGG + Intronic
1203519735 Un_GL000213v1:34438-34460 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1185700367 X:2226953-2226975 GAGCTGCTGCAGAATAAGAAGGG + Intronic
1186839547 X:13471423-13471445 GAGCTACAGCAGAGTGAGCCTGG + Intergenic
1187779158 X:22798150-22798172 GATCTTTAGCAGAATGTGTAGGG - Intergenic
1187866581 X:23728311-23728333 CAGCTTGAGCACAATGAAGAGGG + Intronic
1188314774 X:28659496-28659518 GAGCTCCAGCCGAAGGAGAAGGG - Intronic
1189081614 X:37978873-37978895 GAGGTTCAGGAGAAGAAGGAAGG + Intronic
1194086729 X:89537368-89537390 GAGCCCCAGCAACATGAGGAGGG - Intergenic
1194135939 X:90141710-90141732 AAGCTTCAGCAAAATAATGAGGG - Intergenic
1194725988 X:97398071-97398093 GAAGTTCAGTAGAATGAGGTCGG - Intronic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1196721068 X:118854357-118854379 GAGCTTTGGGAGAATGAGGCAGG + Intergenic
1197135467 X:123054833-123054855 CAGCTTCTTCAGAATGAAGAAGG - Intergenic
1197179034 X:123514422-123514444 GAGCTCCAGCCGAAGGAGAAGGG + Intergenic
1197546397 X:127830292-127830314 GAGCTACAGAAGAAGGAAGATGG - Intergenic
1198826259 X:140701250-140701272 ATGCCTCAGCAGAATAAGGAAGG + Intergenic
1200094976 X:153654270-153654292 GTGATACAGCAGAATGTGGAGGG + Intergenic
1200439387 Y:3193241-3193263 GAGCCCCAGCAACATGAGGAGGG - Intergenic
1200481693 Y:3711786-3711808 AAGCTTCAGCAAAATAATGAGGG - Intergenic
1201239636 Y:11946353-11946375 TAGCTTCAGCAGAACAAGCACGG + Intergenic
1201940029 Y:19449351-19449373 TAGCTTCTGCTCAATGAGGAAGG - Intergenic