ID: 913011747

View in Genome Browser
Species Human (GRCh38)
Location 1:114690165-114690187
Sequence GGAGGTGTTAAGTGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913011747_913011752 17 Left 913011747 1:114690165-114690187 CCTGCTCTGCACTTAACACCTCC 0: 1
1: 0
2: 2
3: 14
4: 200
Right 913011752 1:114690205-114690227 CCATTTCTTAATCTGTAAAGTGG No data
913011747_913011753 18 Left 913011747 1:114690165-114690187 CCTGCTCTGCACTTAACACCTCC 0: 1
1: 0
2: 2
3: 14
4: 200
Right 913011753 1:114690206-114690228 CATTTCTTAATCTGTAAAGTGGG 0: 1
1: 10
2: 96
3: 649
4: 3254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913011747 Original CRISPR GGAGGTGTTAAGTGCAGAGC AGG (reversed) Intronic
900959015 1:5907550-5907572 GGAGGTGCTCAGTCCAGTGCTGG - Intronic
902976147 1:20089991-20090013 GGAGGAGTTGGGTGCAGAACTGG + Intronic
904042732 1:27593683-27593705 GGAGGGGTTCAGAGCAGAGGTGG - Intronic
904421889 1:30399328-30399350 CGAGGTGTTGAGTTCAGAGGTGG - Intergenic
906421567 1:45672574-45672596 GGAGATGTTAAGTAGATAGCTGG + Intronic
906520476 1:46464200-46464222 GGAGGTGTTAAGAGGCGAGTGGG - Intergenic
907169191 1:52445154-52445176 GGAGGTTTTAGCTTCAGAGCAGG - Intronic
908271290 1:62425043-62425065 GGCGGTGTTACATGCAGAGCAGG + Intergenic
912438613 1:109680685-109680707 GGGGGTGTTAAATGCAGGGAGGG + Intronic
912441134 1:109699130-109699152 GGGGGTGTTAAATGCAGGGAGGG + Intronic
913011747 1:114690165-114690187 GGAGGTGTTAAGTGCAGAGCAGG - Intronic
915696822 1:157751762-157751784 AGAGATGTTAAGTGCTCAGCTGG + Intronic
915933048 1:160071935-160071957 GGAAGTGATGAGTTCAGAGCTGG + Intergenic
916964751 1:169926108-169926130 GGAGGTGTTCAGAAGAGAGCTGG - Intronic
919237581 1:194866202-194866224 GAAGATCTTATGTGCAGAGCAGG - Intergenic
920988078 1:210909290-210909312 GAAGGTGTTATATGCAAAGCTGG - Intronic
923215371 1:231843842-231843864 GGAGATGTTCAGTGGAGAGCTGG + Intronic
923554647 1:234991118-234991140 GGAGGGTTTAAGTGCACACCAGG - Intergenic
923647011 1:235833901-235833923 GGAGGTTTTAAGTTAAGAACTGG - Intronic
1064686429 10:17867002-17867024 GGAGGTGATAGCGGCAGAGCAGG - Intronic
1064793584 10:18987290-18987312 GGAAGTGTCTAGTGAAGAGCGGG + Intergenic
1065232601 10:23613690-23613712 GGAGCTGGTGAGTGGAGAGCTGG + Intergenic
1066009352 10:31180030-31180052 GGAGGGGTTAAGAGCACAGAGGG + Intergenic
1066580104 10:36871118-36871140 GGAGATTTTAAGTGCAGACTCGG + Intergenic
1067836234 10:49643567-49643589 GGAGGGGAGAAGGGCAGAGCAGG + Intronic
1069881554 10:71596816-71596838 GGAGGAGTGAAGTGCTGAACTGG + Intronic
1070426669 10:76295261-76295283 GGAAGAGCTAAGAGCAGAGCTGG + Intronic
1073560910 10:104496068-104496090 GGAGGGGCTATGTGCAGAGAAGG - Intergenic
1074291484 10:112140868-112140890 GTGGCTGGTAAGTGCAGAGCAGG + Intergenic
1074662255 10:115673984-115674006 GGATGTATTAAGTGTAGTGCTGG - Intronic
1075083077 10:119396860-119396882 GGAGCTGTTAAGTGCTGGGCTGG + Intronic
1076610425 10:131722747-131722769 GGATGTGGAAAGTGCAGAGAGGG - Intergenic
1076629966 10:131846609-131846631 GGTGGGGTTGAGTGCACAGCTGG - Intergenic
1078051263 11:7966975-7966997 GGAGATGTGAAGTCCAGAGAAGG + Intergenic
1079076608 11:17388765-17388787 GGAGGTGTTAAGTTCTGAGCTGG - Intronic
1080467669 11:32513052-32513074 GGAGGAGTTCAGTGGGGAGCTGG + Intergenic
1080829364 11:35877039-35877061 GGAGGAGTTAAGTGAGAAGCTGG + Intergenic
1081707905 11:45196320-45196342 GGAGCTGTTAAGTACACAACCGG - Intronic
1081809951 11:45909087-45909109 GGAGGTGGCATGTCCAGAGCGGG - Intergenic
1082871418 11:57946308-57946330 GGGGGTGTGGAGGGCAGAGCTGG + Intergenic
1083775966 11:64894454-64894476 GGAGGTGCTGGGTGCAGAGGTGG + Intergenic
1084420765 11:69059405-69059427 GGAGGTGGGAAGTGGAAAGCTGG + Intronic
1084969896 11:72765414-72765436 GGAGCTGTGGAGTGCAGTGCTGG - Intronic
1086439649 11:86815288-86815310 GTTAGTGATAAGTGCAGAGCAGG - Intronic
1086460325 11:86999407-86999429 GCATATGTTAAGTGCAGAGTGGG - Intergenic
1087007313 11:93482741-93482763 GCACGTGCTCAGTGCAGAGCTGG + Intronic
1088840499 11:113623624-113623646 GGAGGTGGTAAGTGATGATCGGG + Intergenic
1089643699 11:119864325-119864347 GGTGGTGTTAGGTGCTGAGCAGG - Intergenic
1091048240 11:132344609-132344631 GGAGGAGTTAACTGCAGACTGGG + Intergenic
1091440622 12:509734-509756 GGAGGTGCTGAGAGCGGAGCTGG + Intronic
1092765747 12:11851101-11851123 GGAGGTGCTGACTGCAGAGGTGG - Intronic
1096549112 12:52360605-52360627 GTAGGAGTTAAGTGAAGGGCTGG + Exonic
1096783909 12:54006383-54006405 GGAGGAGATAAGTGCAAAGCAGG + Intronic
1096928311 12:55173703-55173725 GGATGTGTTAAGTGCTGATGGGG - Intergenic
1097887122 12:64740151-64740173 GGAAGTGTTTAGTGTAGACCAGG - Intronic
1102040345 12:109796764-109796786 GGAGGCGTCATGTGCTGAGCTGG - Intronic
1103724909 12:122992678-122992700 GGGGGTGTTGGCTGCAGAGCTGG + Intronic
1104971453 12:132532697-132532719 CGGGGTGTTAAGCGCAGTGCAGG + Intronic
1105823083 13:24097125-24097147 GGAGGGATTAAATGCAGAGAGGG + Intronic
1105939620 13:25135771-25135793 GGAGGAGCAAAATGCAGAGCAGG + Intergenic
1112381804 13:98897943-98897965 GGTAGTGTTAGCTGCAGAGCTGG - Intronic
1112462368 13:99614116-99614138 GGAGGGGATGAGTGCAGGGCAGG + Intronic
1114557932 14:23572338-23572360 GGAGGTGCTAACTGCAAAGAAGG - Intronic
1115971894 14:38953993-38954015 TTAGGTGGTAAGTTCAGAGCTGG - Intergenic
1118391537 14:65299897-65299919 GAAGGAGTTATCTGCAGAGCCGG + Intergenic
1121067247 14:90979722-90979744 CGATATGTTTAGTGCAGAGCCGG - Intronic
1121588661 14:95082324-95082346 GAAGGTGTTTGGTGCAGAGCTGG - Intergenic
1122637138 14:103135420-103135442 GGAGCTGTTAAGAGCAGCGCTGG + Exonic
1124835630 15:33194162-33194184 GGATGTGTTTAGCGCAGAGGGGG - Intronic
1125168556 15:36739837-36739859 GGATGTGATATGTGCAGAGATGG - Intronic
1125896004 15:43302189-43302211 GGAGGTGCTAAGTCAAGAGAGGG - Intronic
1128834422 15:70797668-70797690 AGAGGTGTTAAGTGAGAAGCAGG - Intergenic
1129521849 15:76191254-76191276 GAAGGTGATAAGTGCAATGCAGG + Intronic
1131609063 15:93941716-93941738 CGAGGTGAAAACTGCAGAGCTGG + Intergenic
1131633493 15:94205456-94205478 TGAGGTTTTAAGTGAAGAGTGGG - Intergenic
1133889596 16:9866760-9866782 GGAGGTGGTCAGTGGAGAGATGG - Intronic
1134016565 16:10892470-10892492 GGAGGAGGTAAGAGGAGAGCTGG - Intronic
1135509783 16:23072271-23072293 GAAGGTGTTACGAGCTGAGCTGG + Intronic
1138281282 16:55773737-55773759 GCAGGTGATCAGGGCAGAGCTGG + Intergenic
1138287257 16:55820124-55820146 GCAGGTGATCAGGGCAGAGCTGG - Intronic
1139605270 16:68013778-68013800 CGAGGAGTCAAGTGCAGAGAGGG - Intronic
1139668140 16:68472567-68472589 GGAGGTGGTGAGTGAAAAGCAGG + Intergenic
1140121326 16:72085356-72085378 GGAGAGGGTAGGTGCAGAGCTGG - Exonic
1140779700 16:78283310-78283332 GGAGGTGTGGAGTGGGGAGCAGG - Intronic
1142284854 16:89167547-89167569 GAGGGTGTTCAGGGCAGAGCTGG - Intergenic
1142601141 17:1053496-1053518 GGAGGTGATCTGTGCAGAGCTGG - Intronic
1142846994 17:2686277-2686299 CCATGTGTAAAGTGCAGAGCTGG - Intergenic
1143677638 17:8447497-8447519 GGAAGTGTTAAGAGCACAGAGGG - Intronic
1145009774 17:19361446-19361468 GGAGGTGCTGAGAGCAGAGCAGG + Intronic
1145934188 17:28705451-28705473 GAAGGTGCTGAGTGAAGAGCAGG - Intronic
1146467138 17:33095291-33095313 GGAGGTGGTGAGTGCAAAGGTGG - Intronic
1149031276 17:52085318-52085340 GGAGGTGTGAAGACCACAGCAGG - Intronic
1150221860 17:63500123-63500145 ACAGGTGATAAGTGCAGAGGTGG - Intronic
1150343459 17:64386967-64386989 GGAGGTGTTGAGAGGGGAGCTGG + Intronic
1150445398 17:65224308-65224330 GGAGGTGTTCAGTGGAGAAAGGG - Intronic
1151433739 17:74081581-74081603 GGAGGTGGTAAGGGGAGAGGAGG - Intergenic
1151705033 17:75762966-75762988 GGAGCTGCTGAGTGCAGGGCGGG + Intronic
1152032929 17:77854862-77854884 GGAGGTGTGGAAGGCAGAGCTGG + Intergenic
1157570777 18:48710566-48710588 AGAGGTGGTAAGAGCAGAGCTGG + Intronic
1160433263 18:78826917-78826939 CCAGGTGTCAGGTGCAGAGCTGG - Intergenic
1161604828 19:5208849-5208871 GGAGCTGGGAAGGGCAGAGCTGG - Intronic
1162730750 19:12717039-12717061 GGTTCTGTTAAGTGCAGAGATGG + Intronic
1163564263 19:18040591-18040613 TGAGGTGTCAAGCACAGAGCAGG - Intergenic
1165408547 19:35644556-35644578 GGCGGTGTGCAGTGCAGACCTGG - Intronic
1165735381 19:38172469-38172491 GGAGGTGATAAGTGCTGGGGAGG + Intronic
1166959117 19:46487479-46487501 TGAGGTGTGCAGTGAAGAGCTGG - Intronic
1167659865 19:50790334-50790356 GGGGGTGCTGAGTGCAGGGCTGG + Intergenic
1167777535 19:51570335-51570357 GGTGGCTTTAAGTGCAGAGATGG + Intergenic
1168589041 19:57617591-57617613 GGAGGTGTCAAGTAGACAGCTGG + Intronic
924980709 2:217995-218017 GGAGCTGTAAAGTGCATAGCTGG + Intronic
925284962 2:2709771-2709793 GGAGGTGCTTAGCACAGAGCAGG + Intergenic
925664050 2:6234181-6234203 GCAGGCAGTAAGTGCAGAGCCGG + Intergenic
926005549 2:9370897-9370919 GCAGGTGTCAACTGCACAGCAGG - Intronic
926534612 2:14095521-14095543 GCAGGTTTTAAGGGCAGTGCTGG - Intergenic
927872984 2:26635319-26635341 GGAGGTGTCATCTGCAGATCTGG + Intronic
933215961 2:79630164-79630186 GGAGGTGGCAAGGGGAGAGCAGG - Intronic
935925961 2:108068712-108068734 GTGGCTGTTAAGGGCAGAGCCGG - Intergenic
937866082 2:126752831-126752853 AGAGCTGTTAAGTGCTGGGCAGG - Intergenic
940129180 2:150362173-150362195 GGAGGTGGGAAGTGCCGAGAGGG - Intergenic
940344977 2:152619628-152619650 GGAGGTGCTAAGGGAGGAGCTGG - Exonic
942560371 2:177212868-177212890 GGAGGTATTAGGGGGAGAGCGGG + Exonic
947536377 2:230942596-230942618 GGAGGAGTGAAGAGCAGAGAGGG + Intronic
948258068 2:236583058-236583080 GGAGGTGGTGAGGGCAGTGCTGG - Intergenic
948851622 2:240711148-240711170 GAAGGTGTGGAGTGCAGAGCAGG + Intergenic
1169938381 20:10910392-10910414 GGAGGTGGGAAGTGGAGAGACGG - Intergenic
1170111968 20:12814902-12814924 GTAGGTGTTAACAGCAGGGCTGG + Intergenic
1172766923 20:37355946-37355968 GGGGGTGATGAGAGCAGAGCAGG + Intronic
1175196028 20:57243937-57243959 GGAGGTTTCCAGAGCAGAGCCGG + Intronic
1175802274 20:61807579-61807601 GCAGGTGTTCCGTGCAGGGCTGG + Intronic
1180856965 22:19053541-19053563 GGAGGTCTTTAGTACAGTGCAGG - Intronic
1181413325 22:22740672-22740694 GAAGGTGTTAAGTGAAGAAATGG + Intronic
1182481893 22:30614550-30614572 GGAGGTCATCAGTGCAGACCTGG - Intronic
1182703694 22:32261198-32261220 GGAGGGGTCAGCTGCAGAGCTGG + Intergenic
1182853488 22:33496783-33496805 GGAGTTTTTAAGTGCAGAAGTGG - Intronic
1184981679 22:48100006-48100028 GGAGCTGCTCTGTGCAGAGCTGG + Intergenic
1185160941 22:49229472-49229494 GTAGGTGTTGAGTTGAGAGCAGG - Intergenic
1185206367 22:49541394-49541416 GGGGGTGTGGAGTGGAGAGCAGG + Intronic
953149049 3:40307865-40307887 TGAGGTGTAAAGTTTAGAGCTGG - Intergenic
953347472 3:42188264-42188286 GGAGGTGTTTGGTCCAGAGAAGG - Intronic
953957655 3:47244197-47244219 GGGTGTGAGAAGTGCAGAGCAGG + Intronic
955701149 3:61683496-61683518 GGAGCTGTTAAGTGTAGAGAGGG - Intronic
960129746 3:114043326-114043348 GGAGGGGTAATGTGCAGATCAGG + Intronic
960155610 3:114294714-114294736 GGAGAGGTTAAGTGCTGAGAGGG + Intronic
960436275 3:117630766-117630788 GCAGGTGTTCAAGGCAGAGCAGG - Intergenic
960903787 3:122577746-122577768 GCAGGTGTTACTTCCAGAGCCGG + Exonic
961453494 3:127013223-127013245 GCAGGTGGAAAGTGCAGGGCAGG - Intronic
962364356 3:134767824-134767846 GGAGGAGATAGGTGCAGAACTGG + Intronic
965516206 3:169624170-169624192 AAAGGTGTTAAGTGAAGGGCAGG - Intronic
966588987 3:181658832-181658854 GTAGCTGGTAAGTGCAGAGCAGG - Intergenic
970298056 4:14652542-14652564 GGAAGTATTCAGTGCAGGGCTGG + Intergenic
977172445 4:93780105-93780127 GGAGGTGGTAAGTGCTGTGGAGG + Intergenic
978973790 4:114843783-114843805 AGAGATGAAAAGTGCAGAGCGGG - Intronic
981447558 4:144857701-144857723 TGAGGTGTTCAGTGGAGACCTGG + Intergenic
982375760 4:154688945-154688967 GGAGTTGCTAAGTACACAGCTGG - Intronic
982575803 4:157108479-157108501 GGAGGAATTAACTGCAGAGATGG + Intronic
985745125 5:1642543-1642565 GGAGGTAGAAAGGGCAGAGCTGG - Intergenic
986677817 5:10202297-10202319 AGGGGTGTTAAGGGGAGAGCAGG + Intergenic
987012673 5:13783082-13783104 GTATGTCTTAGGTGCAGAGCTGG + Intronic
988551565 5:32204985-32205007 GCAAGTATTAAGAGCAGAGCAGG - Intergenic
991949571 5:71934134-71934156 GGGGGTGTTTAGTCCAGACCTGG + Intergenic
993027573 5:82664040-82664062 GGAGGTGATAAGTAGAGAACTGG + Intergenic
997675566 5:135710150-135710172 GGAGCTGGTAAATGCAGAGAGGG + Intergenic
999054637 5:148561098-148561120 GGAGGTGGTTGGTGCACAGCTGG + Intronic
999284746 5:150387700-150387722 GGAGTTGTGAAGTGCTGTGCTGG + Intronic
999911233 5:156202189-156202211 GGAGGAGTTAAGTGGTGAGTGGG - Intronic
1001647164 5:173290510-173290532 GGAGGTGTCTGGTGCTGAGCAGG - Intergenic
1002864423 6:1108336-1108358 GAAGGTGTTGGGTGCAGAGGAGG - Intergenic
1003050359 6:2775272-2775294 GGAAGTGTGATGTGCAGATCTGG - Intronic
1003133159 6:3412980-3413002 GGACTTGTGAACTGCAGAGCTGG + Intronic
1003602343 6:7529271-7529293 TGAGCTGGTAAGTGCAAAGCTGG - Intergenic
1003792510 6:9562684-9562706 AGAGGTGTCAGGTGCAGTGCGGG + Intergenic
1004068282 6:12272892-12272914 GAAAGTGTTTAGAGCAGAGCAGG + Intergenic
1004119058 6:12801572-12801594 GGAGGAATTAATTGCAGAGAAGG + Intronic
1006079908 6:31559166-31559188 GGGGGTGTTAAGTGGGGAGGAGG - Intergenic
1007266066 6:40596894-40596916 GGAGGTGAAAAGTTCAGAGTCGG + Intergenic
1008132318 6:47733075-47733097 GGAGCTGTTAGGGGCAGAGAGGG - Intergenic
1011112649 6:83854776-83854798 AGAGCTGTTAAATGAAGAGCTGG + Intronic
1011664973 6:89624607-89624629 GGAGGAGATAAAAGCAGAGCTGG + Exonic
1013477375 6:110521438-110521460 AGAGGGGTTAAATGTAGAGCTGG - Intergenic
1015333732 6:132010742-132010764 GGAGGTGTTGAATGCATGGCTGG + Intergenic
1016848744 6:148595037-148595059 GGAGGGGCTGAATGCAGAGCAGG - Intergenic
1018373322 6:163187800-163187822 GGAGGTGCTAAGTGCGCAGGTGG - Intronic
1019268773 7:134236-134258 CGAGGTGCTCAGTGCAGAGGAGG + Intergenic
1019687102 7:2388120-2388142 GGAGATGGGAAGTGCTGAGCTGG - Intergenic
1019838775 7:3417709-3417731 TAAAGTGTTTAGTGCAGAGCTGG + Intronic
1021831168 7:24611762-24611784 GGTGGTGGTAAGTGCAGGGAGGG + Intronic
1021854718 7:24843126-24843148 GGAGGACTTAAGTCCTGAGCTGG + Intronic
1023685999 7:42736421-42736443 GAAGGTGTTAAGGTCAGAGAAGG + Intergenic
1023873410 7:44274662-44274684 GGAGGTACTATGTGCAAAGCAGG + Intronic
1029457990 7:100680577-100680599 GGAAGGGTCAGGTGCAGAGCTGG + Exonic
1029600264 7:101559154-101559176 GGAGGTCCTGAGGGCAGAGCTGG - Intergenic
1032382224 7:131497214-131497236 GGAGGTGGAAAGGGCAGAGAGGG - Intergenic
1032527208 7:132587773-132587795 TGAGGTGTACAGTGCAGAGTGGG - Intronic
1033021069 7:137724767-137724789 GGAGGTGTGGAGTGCAGGGGAGG + Intronic
1033641130 7:143263992-143264014 GGAGGCGCTAAGTGCAGAGCAGG - Intronic
1034576480 7:152003343-152003365 GGAGATGTGCAGTGCACAGCTGG - Intronic
1035187558 7:157138612-157138634 GGAGGTGTTGGGTGCGGGGCAGG - Intergenic
1035953580 8:4051586-4051608 AGAAGTGCTAAGTGCACAGCGGG + Intronic
1039611492 8:38922863-38922885 GCAGGTGGTAAATGCAGCGCTGG + Intronic
1039799617 8:40942760-40942782 ACAGTTGTTAAGTGTAGAGCTGG - Intergenic
1040848653 8:51874347-51874369 GGAGTTGTTAAATGCAGCCCCGG - Intronic
1044004180 8:86921923-86921945 AGAGGTGGTAAGTGCAGTGTAGG + Intronic
1048007512 8:130431386-130431408 GGATGTGTTGAGGTCAGAGCAGG - Intronic
1049069416 8:140345256-140345278 GGAGGTGCTGAGGACAGAGCAGG + Intronic
1049873966 8:145003272-145003294 GGAAGTGCTAGGTGCACAGCGGG - Intergenic
1055425947 9:76196942-76196964 TGAGTTGTTAAGTTCAGAACAGG + Intronic
1056128752 9:83563582-83563604 GGAGGTGTTAAGAGAACAGATGG - Intergenic
1060150794 9:121286981-121287003 GGAGGTGTTATTTGCAGATGGGG + Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060929250 9:127478628-127478650 GGTGGTCTGAAGAGCAGAGCAGG - Intronic
1061407353 9:130399732-130399754 GGAGGTGTCCAGTGCAGCACAGG - Intronic
1187987333 X:24828557-24828579 AGAGGTTTTCAGTGGAGAGCGGG - Intronic
1189164493 X:38847077-38847099 GGAGGTGGAAAGTGCTGATCTGG + Intergenic
1190136309 X:47802297-47802319 GGAGGTTTTAGAGGCAGAGCAGG + Intergenic
1195030660 X:100924460-100924482 GGAGGTGGGAGGGGCAGAGCAGG - Intronic
1196020579 X:110986827-110986849 GGAGCTGTTAAGGGGAGAGATGG + Intronic
1199868445 X:151875237-151875259 GGAGGAGTTAAATGAAGACCTGG + Intergenic