ID: 913014101

View in Genome Browser
Species Human (GRCh38)
Location 1:114715476-114715498
Sequence CTTGTCCTGCCTACCACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913014101_913014107 15 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014107 1:114715514-114715536 AACATGAGGAAAATGAGGTTGGG No data
913014101_913014105 10 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014105 1:114715509-114715531 TTTAAAACATGAGGAAAATGAGG No data
913014101_913014104 1 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014104 1:114715500-114715522 TTATGGTAATTTAAAACATGAGG No data
913014101_913014106 14 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014106 1:114715513-114715535 AAACATGAGGAAAATGAGGTTGG 0: 1
1: 1
2: 2
3: 68
4: 732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913014101 Original CRISPR CTTGTCCTGCCTACCACACA GGG (reversed) Intronic