ID: 913014101

View in Genome Browser
Species Human (GRCh38)
Location 1:114715476-114715498
Sequence CTTGTCCTGCCTACCACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913014101_913014107 15 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014107 1:114715514-114715536 AACATGAGGAAAATGAGGTTGGG 0: 1
1: 0
2: 4
3: 128
4: 936
913014101_913014104 1 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014104 1:114715500-114715522 TTATGGTAATTTAAAACATGAGG 0: 1
1: 0
2: 3
3: 36
4: 393
913014101_913014105 10 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014105 1:114715509-114715531 TTTAAAACATGAGGAAAATGAGG 0: 1
1: 4
2: 35
3: 581
4: 4766
913014101_913014106 14 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014106 1:114715513-114715535 AAACATGAGGAAAATGAGGTTGG 0: 1
1: 1
2: 2
3: 68
4: 732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913014101 Original CRISPR CTTGTCCTGCCTACCACACA GGG (reversed) Intronic
900890917 1:5449149-5449171 ATTATCCTGCCTGCCACAGATGG - Intergenic
902238854 1:15074986-15075008 CCTGTCCTGCCTACCTCACAGGG - Intronic
902567364 1:17321060-17321082 ATTGTTCTGCCTACCACAGAGGG + Intronic
902661668 1:17908576-17908598 CCTGTTCTGCCTACCTCACCAGG + Intergenic
905553640 1:38863725-38863747 CTTGTCCCACCTACTTCACAGGG + Exonic
906038554 1:42767910-42767932 TCTGTACTGCCTACCTCACAAGG - Intronic
906312928 1:44766813-44766835 CTGGTCCTTGCTACAACACAGGG - Exonic
907454181 1:54564688-54564710 CTTGTCCCTCCCACCACTCACGG - Intronic
907964612 1:59317099-59317121 CTCATACTGCCTACCTCACAGGG + Intronic
908268086 1:62397743-62397765 ATTTTTCTGCCTACCACACCAGG - Intergenic
912224276 1:107715141-107715163 CCTGCCCTTCCTACCATACAAGG + Intronic
912711687 1:111954338-111954360 CTGGCTCTGCCTACCACAGATGG - Intronic
913014101 1:114715476-114715498 CTTGTCCTGCCTACCACACAGGG - Intronic
913094328 1:115502249-115502271 CTGATCCTTCCTACGACACATGG - Intergenic
913289321 1:117258012-117258034 CTTGTCCCTCCCACGACACATGG + Intergenic
913294806 1:117309033-117309055 CCTGACCTGCCTACCTCCCAGGG + Intergenic
913453382 1:119007677-119007699 CTTCTCCTTCCTCCCCCACAGGG - Intergenic
913657370 1:120974204-120974226 CTTGTCTTGCCTACTTCACCTGG + Intergenic
913666103 1:121050286-121050308 CTTGTCCTGACTGCGTCACAGGG - Intergenic
914008716 1:143757286-143757308 CTTGTCTTGCCTACTTCACCTGG + Intergenic
914017503 1:143833562-143833584 CTTGTCCTGACTGCGTCACAGGG - Intergenic
914521926 1:148425484-148425506 CTTGTCTTGCCTACTCCACCAGG + Intergenic
914647346 1:149665939-149665961 CTTGTCTTGCCTACTTCACCTGG + Intergenic
914656114 1:149742094-149742116 CTTGTCCTGACTGCGTCACAGGG - Intergenic
915064652 1:153214902-153214924 ATTATTCTGCCTACCACAGAAGG + Intergenic
915286888 1:154858906-154858928 CTTTCCCTGCCTTCCTCACAGGG + Intronic
917328516 1:173858329-173858351 CTTGCCCTGGCTACCTCACCGGG + Exonic
918371596 1:183866924-183866946 CTTGTCCTGCCACCAACACCTGG - Intronic
918570035 1:185979266-185979288 CTTTTCCTGCCTATCAAACTTGG - Intronic
919832380 1:201551033-201551055 TTTGTCCTGCCCACCTCATAAGG - Intergenic
921346265 1:214188508-214188530 CTTGTCCTCTCTACCTCACAAGG + Intergenic
1064381345 10:14844223-14844245 CCTGCCCTGCCTACCTCACAGGG + Intronic
1064381581 10:14846650-14846672 ATTGTCCTACCTACCTCACAGGG + Intronic
1066439905 10:35428483-35428505 CTGCTCCTGCCTACCTCTCAGGG - Intronic
1067787928 10:49264476-49264498 CTGGTCCTGCTTGCCACACATGG - Intergenic
1068366656 10:56059472-56059494 CATGTCCTTCCCTCCACACATGG - Intergenic
1069245290 10:66196952-66196974 TTTGTCCTGCCTAACATACCAGG - Intronic
1069676820 10:70254726-70254748 TTTGTCAAGCCCACCACACAGGG + Exonic
1070539686 10:77407169-77407191 CCAGTCCTGCTTCCCACACATGG - Intronic
1071044432 10:81356394-81356416 CTGGTCCTGCCCTCGACACATGG - Intergenic
1074350117 10:112728438-112728460 GTTGTCCTGCTTACCATGCATGG + Intronic
1074509826 10:114101793-114101815 CTTGTCCTGTCTCCCTCACATGG + Intergenic
1075405369 10:122192254-122192276 CATGCTCTGCCTTCCACACAGGG + Intronic
1078326912 11:10388609-10388631 CCTGTCCTGTCTCCCTCACAAGG - Intronic
1078694982 11:13622141-13622163 CTTGCCTTGCCTACCTCACTGGG - Intergenic
1079585920 11:22126915-22126937 CATGTCCTTCCCACAACACATGG + Intergenic
1079867661 11:25756437-25756459 CTGGTCCTGTCGACCACCCAAGG + Intergenic
1080053746 11:27883975-27883997 CTTGTCCTGCCCTTGACACATGG + Intergenic
1081379725 11:42399793-42399815 CTTGTCCTGCCCTTGACACATGG - Intergenic
1081752273 11:45519767-45519789 TCTGTCGTGTCTACCACACAGGG + Intergenic
1081778852 11:45695994-45696016 CCCATCCTGCCTACCTCACAGGG + Intergenic
1081866668 11:46363993-46364015 CAGGTCCTGCTTACCTCACAGGG + Intronic
1082034033 11:47629684-47629706 GCTGTCCTGCCTATCTCACAGGG + Intronic
1083453688 11:62763618-62763640 CTTGCCCTGCCTAACTCAGAGGG + Intronic
1083462782 11:62825609-62825631 CTTGTCCTTCCTACCAGAGATGG - Intronic
1084094802 11:66904085-66904107 CTTGTCCTACCTACCAGGCGAGG - Intronic
1084626952 11:70315083-70315105 CTGGTCCTGCCCTCAACACATGG + Intronic
1084901226 11:72311420-72311442 CCTGTTCTGCTTACCTCACAAGG - Intronic
1085788714 11:79477208-79477230 ATTATTCTTCCTACCACACAGGG + Intergenic
1086445318 11:86865104-86865126 ATTATTCTGACTACCACACAAGG + Intronic
1087444350 11:98229098-98229120 CTTCTCCTGACATCCACACATGG + Intergenic
1089735554 11:120548163-120548185 CTTGTGCTGCCTGGCACCCAGGG + Intronic
1089898859 11:121960512-121960534 CTTGTCCAACCCACCACCCATGG - Intergenic
1090204016 11:124875092-124875114 CTTGTCCTGTCTCCCACAGGTGG + Exonic
1090421809 11:126580477-126580499 CAGGTCCTGCCTTCCACTCAGGG - Intronic
1090692437 11:129198422-129198444 CAGGTCCTTCCCACCACACATGG - Intronic
1091162426 11:133437251-133437273 CTTGTTCTGCCTGCCACAGACGG + Intronic
1091440489 12:508917-508939 GCTGTCCTGCCAACCTCACAAGG - Intronic
1091601392 12:1919580-1919602 TTTGCCCTCCCCACCACACATGG - Intergenic
1091890302 12:4048397-4048419 CTTGTCCTGGCTCACACAGATGG - Intergenic
1092073014 12:5648699-5648721 GCTGTCCTGCCTACTACACAAGG + Intronic
1092157627 12:6294646-6294668 CTTGCCCTGGCTTCCTCACAGGG + Intergenic
1092455742 12:8641116-8641138 CTTCTGCTTCCCACCACACAGGG + Intronic
1101398920 12:104371730-104371752 TTTGTCCTGACAACCACACAAGG - Intergenic
1101445284 12:104733007-104733029 CTGGTCATACCTACTACACAAGG - Intronic
1101766018 12:107700127-107700149 CTGGTCCTTCCCACAACACATGG + Intronic
1103977040 12:124709736-124709758 ATTGTCCTGAGTACCACCCAGGG + Intergenic
1104003010 12:124872438-124872460 CCTGTCCTACCTACCAGAGAAGG + Intronic
1104006512 12:124896527-124896549 ATTGTTCAGCCTACCACAGAGGG + Intergenic
1104752822 12:131250865-131250887 CTTCTCCTGCCTGACACACCCGG + Intergenic
1105937927 13:25119072-25119094 CTCCTCCTGCCTCCCATACAGGG + Intergenic
1106192263 13:27463893-27463915 CTTGTCCTGCCTCTAAGACAAGG + Intergenic
1109625600 13:64969704-64969726 CGTTGCCTGCCTAACACACAAGG - Intergenic
1110439519 13:75511980-75512002 CGTGTCCTGCCTAACAGAGAAGG - Intergenic
1111647820 13:91053642-91053664 CCTATCCTGTCTACCTCACATGG + Intergenic
1112922795 13:104636286-104636308 ATTCTCCTGCCTACCACAGTGGG + Intergenic
1113246195 13:108398374-108398396 CTTGACCTGCAGAACACACATGG + Intergenic
1113631012 13:111883866-111883888 CTTCTCCTGCCTGCCTCCCATGG - Intergenic
1113826724 13:113261239-113261261 CTTATCCTGCATCCCACACGTGG - Intronic
1115943154 14:38630582-38630604 CAGGTCCTTCCTACAACACATGG + Intergenic
1115944199 14:38641749-38641771 TTTATCCTGCCTACCACTGATGG - Intergenic
1115967289 14:38905069-38905091 ATTATTCTGCCTACCACAGAAGG + Intergenic
1117106569 14:52403412-52403434 ATTATTCTGCCTACCACAGATGG - Intergenic
1118048841 14:62004386-62004408 CTTGTCCCTCCCTCCACACATGG + Intronic
1118498175 14:66329571-66329593 TTTGTCCTGCCTATATCACAAGG - Intergenic
1118778115 14:68986579-68986601 CTTGTCCTGCTTCTCACATAAGG - Intergenic
1119602392 14:75985369-75985391 CTTATCTTGCTTCCCACACAAGG + Intronic
1121368256 14:93333820-93333842 CCTATCCTGACTACCACAAAGGG - Intronic
1122456792 14:101859723-101859745 CTTTTGCTGCCTGCCACACCAGG - Intronic
1124701248 15:31914420-31914442 CTTGTCCAGGCTATCAGACACGG - Intergenic
1124806099 15:32884599-32884621 ATTATTCTGCCTACCACATATGG + Intronic
1125507532 15:40275608-40275630 CTTGCCCTGTCTGCCACATAGGG - Intronic
1126073152 15:44883465-44883487 CCTGGCCTGCCCAACACACAGGG + Intergenic
1126085109 15:45004173-45004195 CCTGGCCTGCCCAACACACAGGG - Intergenic
1126437134 15:48646957-48646979 CTTGTAGTGTCCACCACACAGGG + Intergenic
1127317210 15:57808365-57808387 CCTGTCCTGCAAACCACTCAGGG - Intergenic
1128275750 15:66352439-66352461 CAGGTGCTGCCTACCACACCCGG + Intronic
1129672083 15:77613097-77613119 CCTGCCCTGCCTACCTCACAGGG - Exonic
1130210207 15:81915297-81915319 GTTGGCCTGGCTTCCACACAAGG - Intergenic
1130629186 15:85548562-85548584 CCTGTTCTGCCTACATCACAAGG + Intronic
1130822181 15:87507434-87507456 CTGGTCCCTCCCACCACACATGG + Intergenic
1130885994 15:88093102-88093124 CTTATTCTGCCTACCACAGAAGG + Intronic
1131995576 15:98129685-98129707 CAAGTCCTACCTACCACAAAAGG - Intergenic
1132563564 16:610135-610157 CTGGTTCTGTCTACCGCACAGGG - Intronic
1132605053 16:790156-790178 ATTGTCCTCCCTTCCCCACAGGG + Exonic
1133293279 16:4736671-4736693 CTTGTCCTTCCTACCAGAGCAGG + Intronic
1133517008 16:6519208-6519230 CCTGCCCTGCCTACCACACTGGG + Intronic
1134764397 16:16743989-16744011 ATTGTTCTGTCTACCACACCAGG - Intergenic
1134981661 16:18615225-18615247 ATTGTTCTGTCTACCACACCAGG + Intergenic
1135115582 16:19720468-19720490 ATTGTTGTGCCTACCTCACAGGG + Intronic
1135166431 16:20143093-20143115 CTTGTGGAGCCTATCACACATGG + Intergenic
1137410855 16:48227022-48227044 CTTGTACCACCCACCACACACGG - Intronic
1137875996 16:51997364-51997386 CTCCTCCTTCCTACCTCACAGGG + Intergenic
1138434165 16:56988054-56988076 TTTGTCCTGCCCTCCTCACAGGG + Intergenic
1140492943 16:75355633-75355655 CTTATCCTGCCTTTGACACATGG - Intronic
1142000783 16:87663029-87663051 CTTATCCTGCCAACCCAACATGG - Intronic
1143329090 17:6120783-6120805 CTGGTGCTGCCTCCCGCACAAGG + Exonic
1143524471 17:7464001-7464023 CTTGTGCTGCCTCCCTCACCAGG + Intronic
1143726017 17:8847134-8847156 TTTGTCCTGCCAAACTCACAGGG - Intronic
1146487114 17:33251976-33251998 CCTGGCCTGCTTACCTCACAGGG - Intronic
1147150193 17:38509923-38509945 CCTGACCTGTCTCCCACACAGGG + Exonic
1151564500 17:74890263-74890285 CTGGTCTTGTCTGCCACACAGGG - Intronic
1151764252 17:76124119-76124141 CTGCTCCTGCCTCCCACAAAAGG + Intergenic
1152492704 17:80648448-80648470 CTTGACCTGTCCACCTCACAGGG + Intronic
1152580770 17:81164784-81164806 CTTCACCTGCCCACCCCACAGGG + Intronic
1153588449 18:6647870-6647892 CTGGTCCTTCCCACGACACATGG + Intergenic
1153940496 18:9972694-9972716 CTTGTTCTGCCAACCATACCTGG - Intergenic
1154087554 18:11322242-11322264 CTGGTCCTTCCCACCACACGAGG + Intergenic
1157094169 18:44672108-44672130 GTGGTCCCGCCTACAACACATGG + Intergenic
1157750573 18:50174511-50174533 TTTGTCCTCCCTACCTCAGAGGG + Intronic
1159590429 18:70328754-70328776 GTTGTGCTGCCTACCCCAAATGG - Exonic
1159751920 18:72313347-72313369 CTTGTCCTGTCTACCACTGATGG - Intergenic
1159764362 18:72469968-72469990 TGTGTCCTGCCTCCCAGACATGG + Intergenic
1161541768 19:4856135-4856157 CTTGTCCTGCCTCCAACCCAGGG + Intronic
1164673427 19:30086374-30086396 GTTGTCCTGGCTATCACTCATGG + Intergenic
1165971860 19:39638463-39638485 CTTTTCCTGTCTCCCACCCAAGG + Intergenic
1168190120 19:54732069-54732091 ATTCTCCTGCCTTCCACAAATGG + Intronic
1168192355 19:54748459-54748481 ATTCTCCTGCCTTCCACAAACGG + Intronic
1168205035 19:54843992-54844014 ATTCTCCTGCCTTCCACAAATGG + Intronic
924994079 2:340991-341013 CTTGTGCTGCCTAGCACGGAGGG - Intergenic
925014817 2:514714-514736 CAGGTCCCTCCTACCACACATGG - Intergenic
925282369 2:2693573-2693595 ATTGTCCTGCCTAGCACACCAGG + Intergenic
925663985 2:6233320-6233342 CTGGTCCTGCCTTTGACACATGG + Intergenic
925692602 2:6540140-6540162 CTGGTCCCTCCTACGACACATGG - Intergenic
926464960 2:13176693-13176715 CTTGTCCTGCCCTTGACACATGG + Intergenic
926665035 2:15512407-15512429 ATTGTGTTGCCTGCCACACAAGG - Intronic
926734757 2:16064577-16064599 CTTGTCCCTCCCACAACACATGG + Intergenic
926828711 2:16936203-16936225 CCTGCTCTGCCTACCACATAGGG + Intergenic
927173314 2:20388401-20388423 GCTGCCCTGCCTACCTCACAAGG + Intergenic
927217008 2:20673051-20673073 ATTGTCCTGCATCCAACACAGGG - Exonic
927380539 2:22475144-22475166 CGGGTCCTTCCCACCACACATGG - Intergenic
927940023 2:27097719-27097741 TTTATCCTGCCTACCACAATTGG + Intronic
928528079 2:32162674-32162696 CTTGTGCTGTCTGCCATACAAGG - Intergenic
929320486 2:40538192-40538214 CTAGCCCTGCCTATCTCACAGGG - Intronic
929407944 2:41664636-41664658 CCTGTCCTTCCTATCAAACAAGG + Intergenic
929942325 2:46343922-46343944 CCTGTCTTGCCTACCTCACTTGG + Intronic
930525590 2:52525283-52525305 CTTGTCATGACTCCCACAAAGGG + Intergenic
931192867 2:60022654-60022676 CTTTCCTTGCCTACCAAACAAGG - Intergenic
931690659 2:64832178-64832200 CTTGTCCAACCTACCACCCACGG + Intergenic
931757528 2:65387319-65387341 CTAGTGATGCCCACCACACAAGG + Intronic
932039967 2:68289080-68289102 CACATCCTGCCTACCTCACAGGG + Intronic
932092420 2:68818130-68818152 CCTGCCCTGCCTACCTCACAAGG - Intronic
933667163 2:84972200-84972222 CATGTGCTGCCTACCAGACCAGG + Intronic
933724557 2:85419095-85419117 CGAGTCCTGCCGGCCACACAGGG - Intronic
934716267 2:96546474-96546496 CTTCTCCTGCCCACCACGCAGGG + Intronic
935329015 2:101962737-101962759 CTTGCCCTGCATTCCTCACAGGG + Intergenic
935737352 2:106116887-106116909 CTTGCCCTGCTCACGACACATGG + Intronic
936941677 2:117890437-117890459 CTTGTCCAGCCCACCACTGAAGG + Intergenic
937979859 2:127608632-127608654 CCAGCCCTGCCTACCCCACAGGG - Intronic
940727915 2:157356290-157356312 CCTGTCCTGCCTTCAAAACACGG + Intergenic
941260537 2:163291533-163291555 CTGGTCCTTCCCACCACATATGG - Intergenic
941355299 2:164483569-164483591 CTGGTCCCTCCTACAACACATGG - Intergenic
946128102 2:217582109-217582131 CTTGTTCTGTCTACCTCACTTGG - Intronic
946447953 2:219755632-219755654 CTGGTCCCTCCTACAACACATGG - Intergenic
947099383 2:226603479-226603501 CTTGTCCTGTCTGTCTCACAGGG - Intergenic
947110098 2:226709137-226709159 CTTGGAATGCATACCACACAGGG + Intergenic
948559031 2:238838291-238838313 CAGGTCCTTCCCACCACACATGG - Intergenic
1169314398 20:4576484-4576506 CAGGTCCTTCCTACAACACATGG - Intergenic
1169709863 20:8549495-8549517 CTGGTCCTGCCCTCAACACATGG - Intronic
1170045923 20:12085220-12085242 ATTATTCTGCCTACCACACCAGG + Intergenic
1170644805 20:18188228-18188250 CCAGTCCTGCAGACCACACAGGG - Exonic
1174548156 20:51341992-51342014 CTTGTCCAACCTACAACCCATGG + Intergenic
1175350603 20:58315384-58315406 CCAGTCCTGCATACCTCACACGG + Intronic
1177059661 21:16355041-16355063 CACATCCTGCCTACCTCACATGG - Intergenic
1177472967 21:21582989-21583011 CTGGTCCTGCCTTTGACACATGG - Intergenic
1177653217 21:23984315-23984337 ATTATCCTTCCTACCACAAAAGG + Intergenic
1177890526 21:26798894-26798916 ATTATTCTGCTTACCACACAGGG + Intergenic
1178584497 21:33860862-33860884 CTTGTCCTGCCTACCATGCACGG + Intronic
1178606128 21:34037531-34037553 CTTTTCCTGCCTCCCACTCTTGG + Intergenic
1179040964 21:37801897-37801919 TCTTTCATGCCTACCACACATGG - Intronic
1182158365 22:28097249-28097271 GTTGTCCTGCCTATCGCAAAGGG + Intronic
1182930329 22:34167446-34167468 CTTCTCCTGCCCACCTCAAAGGG - Intergenic
949492878 3:4606241-4606263 CTACTCCACCCTACCACACAGGG - Intronic
949555587 3:5149461-5149483 GTGTGCCTGCCTACCACACACGG - Intronic
950615375 3:14153795-14153817 CTTGCCCTTTCTACCGCACATGG + Intronic
951097635 3:18650353-18650375 CTTGTCTGCCCTACCATACAAGG - Intergenic
951725795 3:25757400-25757422 CCTACCCTGCCTACCTCACAGGG + Intronic
951952797 3:28219683-28219705 CTGGTCCCTCCCACCACACATGG + Intergenic
955604396 3:60684977-60684999 CTTGTCCTCCCTACGCCAGAGGG + Intronic
956614434 3:71156888-71156910 TTGGTCCTGCCTGCCACACTGGG + Intronic
958908657 3:99969110-99969132 CCTGCCCTGCCCTCCACACATGG - Intronic
959041087 3:101424077-101424099 GTTGTCTTGCCTATCAAACAAGG + Intronic
959432825 3:106275896-106275918 CTTGTCCTGCCCTTGACACATGG + Intergenic
959901544 3:111667277-111667299 CTTGTCATGCCTGCCATACAGGG + Intergenic
960050146 3:113231803-113231825 CTTTTCCTGCCTATCTCACAAGG - Intronic
960090874 3:113636931-113636953 CCTGTCCTGCATACTTCACAGGG - Intergenic
960380513 3:116954803-116954825 ATTGTTCTGCCTACCACATGTGG + Intronic
962132141 3:132692188-132692210 ATGGTACAGCCTACCACACATGG - Intronic
962713438 3:138106967-138106989 CCAGCCCTGCCTACCTCACAGGG + Intronic
963417816 3:145020835-145020857 ATTGTTCTGCCTATCACAGATGG - Intergenic
964551388 3:157888670-157888692 AGGGTCCTGCCTAACACACAGGG + Intergenic
964585366 3:158292829-158292851 CTTGCCTTACCTAACACACAAGG - Intronic
965488372 3:169306856-169306878 CTTCTCCTCCTTACCCCACAGGG + Intronic
966285326 3:178288409-178288431 TTGGTCCTTCCTACAACACATGG + Intergenic
967500676 3:190193836-190193858 CTGGTCCTGCATAGCTCACATGG - Intergenic
969985807 4:11209563-11209585 CTTGTCTTGCCTATCACATGAGG + Intergenic
970061646 4:12040227-12040249 CAGGTCCTGCCTTCAACACATGG - Intergenic
970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG + Intronic
970860053 4:20691963-20691985 GTTTTTCTGCCTACCACACATGG - Intergenic
971842717 4:31874927-31874949 ATTATTATGCCTACCACACATGG + Intergenic
973589991 4:52431507-52431529 CTTGACCTGCCTGCTACACAGGG + Intergenic
973809202 4:54553648-54553670 CAGGTCCTGCCTGCCACACAAGG + Intergenic
974681477 4:65169163-65169185 CTTGTTATGCCTACCACAGGTGG + Intergenic
975081374 4:70284396-70284418 CTGGTCCTGCCTTTGACACATGG + Intergenic
978265968 4:106824299-106824321 CTAGTCCTTTCTTCCACACAGGG - Intergenic
980425927 4:132628070-132628092 CTAGTCCTGCCTTTGACACATGG - Intergenic
982360795 4:154516843-154516865 CTTATCCTGCTTACCTCACAAGG + Intergenic
982814282 4:159866602-159866624 CCTGTCCTGCTCACCTCACATGG - Intergenic
985589266 5:756313-756335 CTTGTCCAGTCTTGCACACATGG + Intronic
986689082 5:10298925-10298947 CTTGTCCACCCTACCCCACATGG - Intronic
987045058 5:14100077-14100099 TTTGTCCTGCCTCCTAGACAGGG - Intergenic
987263489 5:16227624-16227646 CTTGTCCTGCCTTTGACACATGG - Intergenic
988178460 5:27758617-27758639 CATGTCCTGCCAAGCACAGAGGG + Intergenic
988710525 5:33769862-33769884 CCTGTCCTGCCTTCCTCCCATGG + Intronic
988785806 5:34564598-34564620 CTTCCCCTCCCTCCCACACAGGG - Intergenic
992537203 5:77719122-77719144 GTTGCCCTGCTTACCACGCAGGG - Intronic
993704553 5:91154891-91154913 GTGGTCCTGCCCACCACACGTGG + Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
994622865 5:102183859-102183881 CTGGTCCTTCCCACAACACATGG - Intergenic
995401451 5:111746966-111746988 CATGTGCTGCCTAACCCACATGG + Intronic
995437820 5:112157820-112157842 ATTATTCTGCCTTCCACACAGGG + Intronic
996600404 5:125256103-125256125 GTTATTCTGCCTACCACAGATGG - Intergenic
997777819 5:136627227-136627249 CTGGTCCTTCCCACGACACATGG + Intergenic
997941090 5:138158166-138158188 CTTGTCCAGCCTACCTCACAGGG - Intronic
1000702856 5:164474528-164474550 ATTATTCTGCCTACTACACAAGG - Intergenic
1002136184 5:177109155-177109177 CTCCTCCTGCCTTCCCCACACGG - Intergenic
1002582145 5:180215403-180215425 GTTATTCTGCCTACCACAGATGG - Intergenic
1002974418 6:2060168-2060190 CTTGTCCAGCCTCCCAAGCAAGG + Intronic
1003823460 6:9926215-9926237 CTAGTCTTTCCTAACACACAGGG + Intronic
1004055141 6:12128630-12128652 CCTGTGCTGCCTGCCTCACAGGG + Intronic
1006367213 6:33622598-33622620 CTCATCCTCCCAACCACACATGG + Intronic
1006475489 6:34249935-34249957 CTTGCCCTGCCTAGCTCACAAGG - Intergenic
1006495557 6:34420590-34420612 CTTGACCTGAGTACCATACAGGG - Intronic
1008593071 6:53013113-53013135 CATGTCTTACCTACCAGACAGGG - Intronic
1009242311 6:61197686-61197708 CTAGTCCTTCCCACCACACATGG - Intergenic
1009441068 6:63679012-63679034 CCTGTCCTACCTACCTCACAGGG - Intronic
1009487080 6:64238247-64238269 CCAGTCCTGCCTAACACCCAAGG - Intronic
1011948178 6:92933814-92933836 CTTGTCCTTCCCATGACACATGG + Intergenic
1012394098 6:98775964-98775986 CTTGTCCTGACTACCTTCCATGG - Intergenic
1012700411 6:102450596-102450618 TGGGTCCTGCCTACAACACATGG + Intergenic
1015676973 6:135761574-135761596 CTGGTCCTTCCCACAACACATGG + Intergenic
1017073585 6:150598592-150598614 CCTGTCCTGTCAACCTCACAAGG + Intergenic
1020339552 7:7095080-7095102 CGAGTCCTGCCTAGCATACACGG + Intergenic
1020392424 7:7672531-7672553 CTGGTCCTGCCCTCGACACATGG - Intronic
1020617310 7:10476093-10476115 CTTGACCTACCAACCTCACAGGG + Intergenic
1021333500 7:19368847-19368869 CTAATCCTTCTTACCACACAGGG - Intergenic
1023546696 7:41325170-41325192 GTTATTCTGCCTACCACACCTGG + Intergenic
1023708568 7:42967898-42967920 CTGGTCCCTCCTACAACACATGG - Intergenic
1023797168 7:43803527-43803549 CGTTGCCTGCCTACCACATAAGG + Intronic
1024555538 7:50600092-50600114 CCTGCGCTGCCTCCCACACACGG + Intronic
1024996298 7:55275352-55275374 CATGTCCTGGCAGCCACACACGG + Intergenic
1026307287 7:69153090-69153112 CTGGTCCTCCCTACCATGCAGGG + Intergenic
1028044894 7:86106265-86106287 CTTGTCCTGCCTTTGACATATGG - Intergenic
1028295625 7:89126918-89126940 CCTGCTCTGCCTACCTCACAGGG + Intronic
1028990327 7:97042444-97042466 CGTATTCTGCCTACCACACCTGG + Intergenic
1030322258 7:108181743-108181765 CTTGTCATGCATACCACAGGAGG - Intronic
1030587043 7:111433563-111433585 CATGTCCTTCCTACAACACATGG + Intronic
1030900808 7:115120937-115120959 CTTGTCCTGCCTGCCTGACAAGG + Intergenic
1031094348 7:117401601-117401623 CTTGTCCAGCCTGTCACTCATGG - Intronic
1031990014 7:128191435-128191457 CCTGCCCTGCCCACCACACAGGG - Intergenic
1036039066 8:5054188-5054210 CTGGTCCTTCCCACAACACATGG + Intergenic
1036067498 8:5398569-5398591 CTGGTCCTTCCAACCACACATGG + Intergenic
1036138029 8:6180303-6180325 ATTGTCCTCTCAACCACACATGG + Intergenic
1036409099 8:8481916-8481938 CTGGTGCTGGCTACCACACCTGG - Intergenic
1037103017 8:15071491-15071513 TTTGTCCTGCCTACTTCACAGGG + Intronic
1038356653 8:26835637-26835659 CTTGTCCCTCCCACGACACATGG + Intronic
1038578401 8:28725337-28725359 CTTGGCCTGTCTCACACACAGGG - Intronic
1039483947 8:37897315-37897337 CTTTTCCTGTCTCCCACAGAAGG + Intronic
1042219524 8:66460067-66460089 CCTCTTCTTCCTACCACACAAGG + Intronic
1046018698 8:108637327-108637349 ATTATTCTGCCTACCACACCTGG - Intronic
1047087684 8:121537073-121537095 ATTATTCAGCCTACCACACATGG - Intergenic
1047183304 8:122609771-122609793 CTGGTCCTGCCTATGACACTTGG - Intergenic
1048323688 8:133422427-133422449 CTTCTCCTTCCTTCCTCACAAGG + Intergenic
1048346211 8:133576754-133576776 CTGGTCCTTCCCACGACACATGG + Intergenic
1048602870 8:135937063-135937085 CTTGTCCCTCCCACAACACATGG + Intergenic
1048809215 8:138270062-138270084 CATGTGCTGCCTAGCTCACAGGG + Intronic
1049223659 8:141439543-141439565 CATGACCTGCCTACCACAGGAGG + Intergenic
1049266230 8:141669316-141669338 TCTGTCCTGCCTGCCTCACAGGG + Intergenic
1050716704 9:8536529-8536551 CTTGTACTGGCTAACAGACATGG - Intronic
1056199752 9:84263663-84263685 CATGTCCTCCCTTCCACAAAGGG - Intergenic
1057062397 9:92017246-92017268 CGGGTTCTGCCTACCTCACAGGG - Intergenic
1057815192 9:98289249-98289271 CCTGTCCTGCCTACCTCACAAGG - Exonic
1058649185 9:107159228-107159250 CCTGTCCTTCCCACAACACAGGG - Intergenic
1058790773 9:108443192-108443214 CGTGTCCTGTCTACCTCCCAGGG + Intergenic
1059894223 9:118842281-118842303 ATTATTCTGCCTACCACAAAAGG + Intergenic
1060474965 9:123979880-123979902 CTGGTCCTGCCCTCGACACATGG + Intergenic
1185589502 X:1265094-1265116 CAGGTCCCACCTACCACACAGGG - Intergenic
1186198520 X:7133121-7133143 CTTTTCCTGCATTCCACACCAGG - Intronic
1186249633 X:7651942-7651964 CTTGTCCCTCCCACAACACATGG - Intergenic
1186775125 X:12857031-12857053 CTTGTCCAACCCACCACCCATGG - Intergenic
1187552617 X:20321461-20321483 CTCCTCCTGCCTACCATACTGGG - Intergenic
1188459705 X:30410173-30410195 CTTGTCCTGCCTCGCTTACAGGG + Intergenic
1189058968 X:37731454-37731476 CTTTTCCAACCTACCTCACAAGG + Exonic
1190284498 X:48953312-48953334 CTTGTCCTGCCCACCAAGCTTGG + Intronic
1190407088 X:50098971-50098993 ATTGCCCTACCTACCTCACAGGG + Exonic
1190482367 X:50889946-50889968 CTTGCCCTGCCCACCACAGCTGG + Intergenic
1192560308 X:72123877-72123899 CCCTTCCTGCCTGCCACACATGG - Intergenic
1192984769 X:76385433-76385455 CTTATCCTGTCTATCACAGATGG - Intergenic
1193151566 X:78129860-78129882 CCTACCCTGCCTACCTCACAGGG - Exonic
1194623657 X:96202568-96202590 CTTGTACTCCCTGCCACCCAGGG - Intergenic
1197643497 X:128992799-128992821 CTGCTCTTGCCTACCACACCGGG - Intergenic
1198225946 X:134646060-134646082 TCTGTCCTACCTACCTCACAGGG + Intronic
1198608956 X:138375723-138375745 ATTGCACTGCCTACCTCACAGGG - Intergenic
1199692353 X:150318205-150318227 ATTTTCCAGCCTACCACGCAGGG - Intergenic
1199928559 X:152494873-152494895 CTGGACCTTCCCACCACACATGG - Intergenic