ID: 913014104

View in Genome Browser
Species Human (GRCh38)
Location 1:114715500-114715522
Sequence TTATGGTAATTTAAAACATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913014101_913014104 1 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014104 1:114715500-114715522 TTATGGTAATTTAAAACATGAGG No data
913014102_913014104 0 Left 913014102 1:114715477-114715499 CCTGTGTGGTAGGCAGGACAAGT No data
Right 913014104 1:114715500-114715522 TTATGGTAATTTAAAACATGAGG No data
913014098_913014104 10 Left 913014098 1:114715467-114715489 CCATAACATCCCTGTGTGGTAGG No data
Right 913014104 1:114715500-114715522 TTATGGTAATTTAAAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913014104 Original CRISPR TTATGGTAATTTAAAACATG AGG Intronic