ID: 913014106

View in Genome Browser
Species Human (GRCh38)
Location 1:114715513-114715535
Sequence AAACATGAGGAAAATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 804
Summary {0: 1, 1: 1, 2: 2, 3: 68, 4: 732}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913014101_913014106 14 Left 913014101 1:114715476-114715498 CCCTGTGTGGTAGGCAGGACAAG 0: 1
1: 0
2: 4
3: 35
4: 295
Right 913014106 1:114715513-114715535 AAACATGAGGAAAATGAGGTTGG 0: 1
1: 1
2: 2
3: 68
4: 732
913014098_913014106 23 Left 913014098 1:114715467-114715489 CCATAACATCCCTGTGTGGTAGG No data
Right 913014106 1:114715513-114715535 AAACATGAGGAAAATGAGGTTGG 0: 1
1: 1
2: 2
3: 68
4: 732
913014102_913014106 13 Left 913014102 1:114715477-114715499 CCTGTGTGGTAGGCAGGACAAGT No data
Right 913014106 1:114715513-114715535 AAACATGAGGAAAATGAGGTTGG 0: 1
1: 1
2: 2
3: 68
4: 732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913014106 Original CRISPR AAACATGAGGAAAATGAGGT TGG Intronic