ID: 913014388

View in Genome Browser
Species Human (GRCh38)
Location 1:114717956-114717978
Sequence AATAATGCACAGTTGCAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913014388_913014391 29 Left 913014388 1:114717956-114717978 CCAGGCTGCAACTGTGCATTATT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 913014391 1:114718008-114718030 TTTTAAACATAACACGAGGAAGG 0: 1
1: 0
2: 3
3: 5
4: 223
913014388_913014390 25 Left 913014388 1:114717956-114717978 CCAGGCTGCAACTGTGCATTATT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 913014390 1:114718004-114718026 ATTTTTTTAAACATAACACGAGG 0: 2
1: 0
2: 1
3: 29
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913014388 Original CRISPR AATAATGCACAGTTGCAGCC TGG (reversed) Exonic
903648077 1:24906599-24906621 CAGCAAGCACAGTTGCAGCCAGG - Intronic
903964744 1:27080104-27080126 AAAAACACACATTTGCAGCCAGG - Intergenic
904088285 1:27926634-27926656 AGTCAACCACAGTTGCAGCCTGG + Intergenic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
906763740 1:48407213-48407235 AATCATTCAAAATTGCAGCCAGG + Intronic
909743772 1:79066762-79066784 AATCATGCACAATTGCTTCCAGG - Intergenic
910724888 1:90328066-90328088 AATAATAAGCAGTGGCAGCCAGG + Intergenic
912259460 1:108095870-108095892 ATGACTGCAAAGTTGCAGCCAGG - Intergenic
912750847 1:112286042-112286064 AAAAGGGCACAGTTTCAGCCTGG + Intergenic
913014388 1:114717956-114717978 AATAATGCACAGTTGCAGCCTGG - Exonic
916362226 1:163983501-163983523 AATAAGGCAAATGTGCAGCCAGG + Intergenic
918746341 1:188205103-188205125 AATCATGCATTGTTTCAGCCAGG + Intergenic
920953663 1:210597990-210598012 AATAATCAACAGTGGTAGCCAGG - Intronic
921326178 1:213987992-213988014 AATAATACACCATTGCAGCCGGG + Exonic
1064387263 10:14907517-14907539 ACTAATGCACAATTACAGCTAGG - Intronic
1067177831 10:43962575-43962597 AGTACTGCACAAATGCAGCCGGG + Intergenic
1068583972 10:58775666-58775688 AATAATGCACAGTTGGGGAGAGG + Intronic
1069710465 10:70484832-70484854 AAGAATGGGCAGTTGCAGCTGGG - Intronic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1073524271 10:104164772-104164794 AATAATCTACAGTGGCATCCAGG + Intronic
1075012288 10:118884959-118884981 AATAATGCACATGTCCAGGCCGG + Intergenic
1075434139 10:122419972-122419994 ACTACAGCACAGCTGCAGCCTGG - Intronic
1076243774 10:128930375-128930397 AAAAATGCACAGTGGCAGATTGG - Intergenic
1081295046 11:41375619-41375641 AATAGGGCACAGTTACTGCCTGG + Intronic
1088949838 11:114556502-114556524 AAAACTGCAGACTTGCAGCCTGG - Intronic
1094007108 12:25766138-25766160 CATAATTCACAGTTTCAGCATGG - Intergenic
1101357361 12:103993034-103993056 TAAAATGCACATTTGCGGCCGGG + Intronic
1116081092 14:40173541-40173563 TTTAATGCAGAGTTGGAGCCTGG + Intergenic
1116666782 14:47786774-47786796 AAAAATAGACAGTTTCAGCCAGG - Intergenic
1117036508 14:51735253-51735275 AATAAAGCAAAGAGGCAGCCAGG + Intergenic
1118241169 14:64060309-64060331 AATAATCAACAGTGGCAACCAGG - Intronic
1118277926 14:64402599-64402621 AAAAAAGCACAAGTGCAGCCTGG + Intronic
1118439429 14:65799296-65799318 AAAACTGAACAGTTTCAGCCAGG + Intergenic
1118889984 14:69900887-69900909 AATAATGGCCAGTTACAGGCTGG - Intronic
1119366912 14:74100769-74100791 AATAATGCAAAAATTCAGCCAGG - Intronic
1124625861 15:31307136-31307158 AATAATGCAATGCTGCAGCGTGG - Intergenic
1127052413 15:55098626-55098648 AAGAATGCACAGTTGAGACCAGG + Intergenic
1127052453 15:55098935-55098957 AAGAATACACAGTTGAAGACAGG + Intergenic
1128764200 15:70241188-70241210 CAAAATGGACAGTTCCAGCCAGG + Intergenic
1128948524 15:71849854-71849876 AATGATGCTCAGTTGAATCCAGG + Intronic
1129512630 15:76136237-76136259 AATAATACACAGCTGCAGGCCGG - Intronic
1136220925 16:28828288-28828310 AATCATTAACAGTTGCAGGCCGG + Intronic
1137633742 16:49967460-49967482 ACTTAAGCACAGTGGCAGCCTGG - Intergenic
1141819156 16:86433062-86433084 AATCATGCTCAGCTGCAGGCAGG + Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1142965864 17:3580719-3580741 AAAAATACACAGTGGAAGCCGGG + Intronic
1143234031 17:5382376-5382398 AAGAATCCACAGTTCCAGTCCGG - Intronic
1143413680 17:6729064-6729086 AATAATTAACAGTGGTAGCCAGG + Intergenic
1150952735 17:69821501-69821523 ACTCAGGCACTGTTGCAGCCTGG + Intergenic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1155443381 18:25885020-25885042 AATAATGACCAGTGGTAGCCAGG + Intergenic
1156242208 18:35265476-35265498 AGTACTGTAGAGTTGCAGCCTGG - Intronic
1157844487 18:50990445-50990467 AAAAATGCACACTTGTGGCCAGG + Intronic
1158618870 18:59013060-59013082 AGAAATCCACAGTAGCAGCCAGG + Intergenic
1162783388 19:13018941-13018963 AATAAAGCATATCTGCAGCCTGG - Intronic
1166275646 19:41751984-41752006 AATGGTGCACTGTTGCAGCAGGG - Intronic
1166459315 19:42972323-42972345 AATTCTGCACGGATGCAGCCAGG + Intronic
1166492123 19:43268979-43269001 AAGAAGGCTCTGTTGCAGCCTGG - Intronic
1168368556 19:55811461-55811483 AATGATGAACAGCTGCAGCAGGG + Intronic
926345564 2:11941949-11941971 AATAATGCAAAGTTAGAGACAGG - Intergenic
927285574 2:21353417-21353439 AATATAGCACAGTTGCTGCATGG - Intergenic
927454515 2:23238025-23238047 AAGAATGCAAAGTGGCAGACAGG + Intergenic
929348261 2:40914661-40914683 ATTAAGGCCCAGTTGCAGCCTGG - Intergenic
930491789 2:52082920-52082942 TATAATGCACAGTTGGAGCCTGG + Intergenic
930950844 2:57142968-57142990 AATAATGCACAGTGTCAGACTGG - Intergenic
932312951 2:70758875-70758897 AGTAATCCAGAGTTTCAGCCAGG + Intronic
936460336 2:112709718-112709740 AACAATGAACAGTAGCTGCCTGG - Intergenic
936929267 2:117770297-117770319 TATAATACACAGATGCAGGCAGG + Intergenic
937504337 2:122519728-122519750 AATACTTCAGAGTTGAAGCCAGG + Intergenic
937677731 2:124610066-124610088 AGTAATGCAAATTTGCAGCTAGG + Intronic
938280120 2:130057854-130057876 AATGATGCACAGGTACAGCTTGG - Intergenic
938331077 2:130448569-130448591 AATGATGCACAGGTACAGCTTGG - Intergenic
938358871 2:130672934-130672956 AATGATGCACAGGTACAGCTTGG + Intergenic
938435264 2:131279587-131279609 AATGATGCACAGGTACAGCTTGG + Intronic
939869268 2:147508784-147508806 AAGAATACACAGTTTCAGGCTGG + Intergenic
941594231 2:167455806-167455828 AATAATGGAGAGATCCAGCCAGG - Intergenic
945003887 2:205382163-205382185 AATAATGCAATGTTGTATCCTGG - Intronic
947828552 2:233123158-233123180 AAAAATGTACAGTCCCAGCCAGG + Intronic
1170559955 20:17548726-17548748 AAAAATACACAGTTGGAGACTGG - Intronic
1174647890 20:52101821-52101843 AAAAATGCAGAGTCTCAGCCGGG + Intronic
1174849203 20:53975651-53975673 ATTAAAACACAGATGCAGCCAGG + Intronic
1175690447 20:61061912-61061934 ATTAAGGCAGAGGTGCAGCCAGG - Intergenic
1176844097 21:13863294-13863316 AAAGATGCACAGGTACAGCCTGG - Intergenic
1176939953 21:14912007-14912029 AATAATCAACAGTGGAAGCCAGG - Intergenic
1179462203 21:41544089-41544111 AGAAATACACAGTTTCAGCCAGG + Intergenic
1180575098 22:16766227-16766249 AAGAATGCAGAGTTTCAGTCTGG + Intergenic
1184652726 22:45926477-45926499 AACAGTGCTCAGTTACAGCCAGG + Intronic
951075378 3:18385325-18385347 AAGAAAACACATTTGCAGCCGGG + Intronic
951218167 3:20043197-20043219 AAAAATGAACACTTTCAGCCAGG - Intronic
951874958 3:27413982-27414004 AAAAATACACAGTTGAGGCCAGG + Intronic
952293212 3:32038367-32038389 AATATTGCACCATTGCAGCCTGG - Intronic
953323990 3:41996954-41996976 AAGAATACACAGTAGGAGCCAGG - Intergenic
955101683 3:55855949-55855971 AAGAATGGACTGCTGCAGCCTGG - Intronic
958959346 3:100494325-100494347 AATAATTAAAAGTTGCAGCCTGG + Intronic
962038795 3:131683299-131683321 AATAATCAGCAGTTGTAGCCAGG - Intronic
963240400 3:142997326-142997348 AATAATTAGCAGTGGCAGCCAGG - Intronic
965231641 3:166061282-166061304 AAAAATAAACAGTGGCAGCCAGG + Intergenic
966872001 3:184296835-184296857 AATAAGACACAGTTCCAGGCCGG + Intronic
968410228 4:384143-384165 AAAAACACACAGTTCCAGCCTGG + Intronic
969204784 4:5635317-5635339 TATAATGCACATTTGTGGCCAGG - Intronic
970466581 4:16329677-16329699 AAAAATGCACAGTTGTTGCCAGG - Intergenic
971223835 4:24733295-24733317 AGAAATGGACAGGTGCAGCCGGG + Intergenic
971317890 4:25582539-25582561 AATAATAAACAGCTCCAGCCTGG - Intergenic
971362991 4:25953949-25953971 AATAGTGCAGGGTTGCAGCAAGG - Intergenic
972286952 4:37658171-37658193 AATAATGCACAATGGCATTCAGG + Intronic
975552355 4:75626677-75626699 AAAAAAGCACAATTCCAGCCTGG + Intronic
976943764 4:90739129-90739151 AATAATGAGCAGTAGCAGGCAGG - Intronic
978817210 4:112921318-112921340 AATAATACACAGAATCAGCCGGG - Intronic
986383792 5:7211183-7211205 AAAAGTGCACAGTTACACCCAGG + Intergenic
987147606 5:15007620-15007642 AATCATCCACAGTTGCAGAAAGG - Intergenic
990514235 5:56517256-56517278 ACTGATGCAGATTTGCAGCCTGG + Intronic
993030564 5:82700690-82700712 AATAATGCACAATAGATGCCTGG - Intergenic
998092384 5:139378946-139378968 AAGAATGCACAGTCAGAGCCGGG + Intronic
998249849 5:140545125-140545147 AAAAACTCACAGTTGCAGTCAGG + Intronic
998538111 5:142953002-142953024 AAAAAAGCACAGTTGGGGCCGGG - Intronic
999105225 5:149064598-149064620 AATAATGTACAGTGAGAGCCTGG - Intergenic
999783075 5:154866607-154866629 AATAATGTTTACTTGCAGCCGGG + Intronic
1003684134 6:8283932-8283954 AATACTGCATAATTCCAGCCAGG - Intergenic
1003833751 6:10044155-10044177 CATAATGCACAGTAGCACCTAGG - Intronic
1003945066 6:11067605-11067627 AACAATGCAGGGTTGCAGTCAGG - Intergenic
1010355880 6:74932614-74932636 AACAGTGCCCAGTTGCAGCTTGG - Intergenic
1014794699 6:125710950-125710972 AATAATCAACAGTGGTAGCCAGG + Intergenic
1017168454 6:151432633-151432655 AATACTCCACAGTAGCTGCCTGG - Intronic
1017949787 6:159127078-159127100 GACAGTGCACAGTGGCAGCCAGG + Intergenic
1021603468 7:22387874-22387896 CATACTCAACAGTTGCAGCCGGG - Intergenic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1024620728 7:51155292-51155314 AAGACTGTACAGTTCCAGCCGGG + Intronic
1027466798 7:78524697-78524719 AAAAATGAACAGTTGCTCCCTGG + Intronic
1027850983 7:83451619-83451641 CACAATGCACACTTGCACCCAGG - Intronic
1028097631 7:86781962-86781984 TATAAGGAAGAGTTGCAGCCTGG - Intronic
1028271987 7:88802956-88802978 AATTATGCACAGTTGCAGACTGG - Intronic
1032599394 7:133277120-133277142 AAAAATGCCCAGTTATAGCCAGG - Intronic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1035146584 7:156823793-156823815 TATAATACACACATGCAGCCGGG + Intronic
1040810075 8:51441904-51441926 AATAATACACACATGAAGCCTGG + Intronic
1042031152 8:64477427-64477449 AAGAATGCAAAGTTGCCGGCCGG + Intergenic
1043479769 8:80641256-80641278 AATAAAACACAGTTGAAGCCAGG - Exonic
1043939042 8:86175451-86175473 AATAATACAGAGTTGCCGCTGGG + Intergenic
1045482178 8:102601278-102601300 AATCATGCACATGTGCTGCCTGG - Intergenic
1045489776 8:102659258-102659280 AGAAATGTACATTTGCAGCCAGG + Intergenic
1045722120 8:105124901-105124923 AATGTTGCACAGATGCATCCAGG + Intronic
1047199261 8:122750842-122750864 AATAAAGCACAGTCTCAGCCAGG + Intergenic
1050440228 9:5654211-5654233 AAAAATACACACTTGCAGCCTGG - Intronic
1050602344 9:7265725-7265747 AAAAAGGCACAGTTTCAGGCTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053550381 9:39073252-39073274 AATACAACACAGTTGAAGCCTGG - Exonic
1053814492 9:41893353-41893375 AATACAACACAGTTGAAGCCTGG - Exonic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054616104 9:67294087-67294109 AATACAACACAGTTGAAGCCTGG + Intergenic
1055657810 9:78469597-78469619 GTTAATGCACATTTACAGCCTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057386718 9:94611456-94611478 AAAAATGCACATTCACAGCCGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059041717 9:110822297-110822319 AATAATCAGCAGTGGCAGCCAGG + Intergenic
1061250871 9:129425653-129425675 ATTAATGAACAGTTGCATGCCGG - Intergenic
1061544393 9:131295854-131295876 AATAATGCTCAGTTACAGGATGG + Intronic
1187379254 X:18785585-18785607 AAAAAATCCCAGTTGCAGCCAGG + Intronic
1187883700 X:23869202-23869224 AAAATTGGACACTTGCAGCCGGG - Intronic
1188161858 X:26814464-26814486 AATAATCCACAGTGGTAGCTAGG - Intergenic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1196258674 X:113552657-113552679 AAAAAAGCAAAGTGGCAGCCAGG - Intergenic
1198109724 X:133492396-133492418 AATAAAGAACACTTACAGCCGGG + Intergenic
1198542439 X:137654092-137654114 AGTAATGCACTGTTTCTGCCTGG - Intergenic