ID: 913016050

View in Genome Browser
Species Human (GRCh38)
Location 1:114736294-114736316
Sequence GTGTGATTGGTTTAGATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913016050 Original CRISPR GTGTGATTGGTTTAGATCTT TGG (reversed) Intronic
907683971 1:56591721-56591743 GTGGGATTGGTTTGGAACATTGG - Intronic
911454433 1:98105389-98105411 CTGTAACTGGTTTAAATCTTGGG + Intergenic
913016050 1:114736294-114736316 GTGTGATTGGTTTAGATCTTTGG - Intronic
917673578 1:177298504-177298526 GTATAATTGGATTAGATATTGGG - Intergenic
917724100 1:177813185-177813207 GTCTGATATGTTTAGATATTTGG - Intergenic
919563551 1:199155459-199155481 GAGTGATTGGTTTGGATTATGGG - Intergenic
921845092 1:219870258-219870280 GTGTCATTGTTTTACATTTTTGG + Intronic
922335028 1:224612285-224612307 GAGGGGTTGGTTTAGCTCTTGGG + Intronic
1064721714 10:18235863-18235885 GTGGGATGGGATTAGATCGTAGG + Intronic
1065564199 10:26992756-26992778 GAGTGGTTGGTTTGGATCCTGGG - Intronic
1069473941 10:68716961-68716983 TAGTGATTGATTTTGATCTTAGG + Intergenic
1069785658 10:70986341-70986363 GTGTAATTGGATTATAACTTAGG - Intergenic
1070047152 10:72849410-72849432 GTGTTATTGGTTGAGATTATGGG + Intronic
1071943010 10:90609466-90609488 GTCTGATTGGTGTAGAGCTCTGG - Intergenic
1073088259 10:100910064-100910086 GTGTGACTGCTTAAGATCTCTGG + Intergenic
1079526567 11:21396663-21396685 GTATGAGAGGTTTAGATCTTTGG + Intronic
1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG + Intergenic
1088569705 11:111211510-111211532 GAGTTATATGTTTAGATCTTTGG - Intergenic
1088686859 11:112290896-112290918 GTGTGATTAGTTCAGTTCATTGG + Intergenic
1092025151 12:5233551-5233573 GTGTGTTTGCTTTAGATATGGGG + Intergenic
1092478474 12:8838974-8838996 GTGAGGTTGGTTTGGATCTTTGG + Intronic
1093635356 12:21460107-21460129 GTGTGATTTCTTTAGAGCATTGG + Intronic
1094650520 12:32371554-32371576 GTTTGTTTGGTTTAGTTTTTTGG + Intronic
1098937164 12:76493237-76493259 TTTTGATTGGTTTGGAGCTTTGG - Intronic
1098970183 12:76846348-76846370 TTGTGATTTATTTAGTTCTTTGG + Intronic
1104108156 12:125682679-125682701 CTGTGATTGGTGTTGAACTTTGG + Intergenic
1106830444 13:33575611-33575633 GTGAGACTGGATTAGTTCTTAGG + Intergenic
1108041447 13:46343293-46343315 GTGACATTGTTTTAGATATTGGG - Exonic
1108138623 13:47393633-47393655 GTGGGATGTGTTTAGATCATGGG - Intergenic
1108956211 13:56161167-56161189 TTGTGATTGCTTTAGCTGTTTGG - Intergenic
1113141224 13:107152364-107152386 GTGTTATTTCTTTAAATCTTTGG + Intergenic
1115877238 14:37874597-37874619 TTGTGTTTGACTTAGATCTTTGG + Intronic
1116081086 14:40173410-40173432 GTGTATCTGGTTTTGATCTTAGG + Intergenic
1116280958 14:42906975-42906997 GTGTAATTGATTTAAATATTTGG - Intergenic
1118982266 14:70726399-70726421 GTCTGATTTGTTTAGAGCCTGGG - Intronic
1120582742 14:86273122-86273144 GTGGGAGTTGGTTAGATCTTGGG - Intergenic
1122382585 14:101319501-101319523 ATGTGCTGGGTTTAGAGCTTAGG - Intergenic
1123491882 15:20787622-20787644 GAATGAATGGTTTAGATCCTGGG - Intergenic
1123548388 15:21356717-21356739 GAATGAATGGTTTAGATCCTGGG - Intergenic
1202956719 15_KI270727v1_random:83947-83969 GAATGAATGGTTTAGATCCTGGG - Intergenic
1134431745 16:14215369-14215391 TTTTGATTGGATTAGATATTTGG + Intronic
1136298194 16:29315694-29315716 GAGAAATTGGTTTAGTTCTTAGG + Intergenic
1138672946 16:58629978-58630000 GTGTGATTGGTTTAAATCCGCGG - Intergenic
1140218985 16:73030040-73030062 GGGTGTTTGGATTAGATGTTGGG - Intronic
1142059840 16:88022198-88022220 GAGAAATTGGTTTAGTTCTTAGG + Intronic
1143475972 17:7204178-7204200 ATGTGAGTTGTTTAGATTTTGGG - Exonic
1146192704 17:30784179-30784201 GTGTTAGTGTTTTAGATGTTTGG - Exonic
1147026665 17:37591333-37591355 TTTTCATTTGTTTAGATCTTTGG - Intronic
1147731465 17:42606123-42606145 CTGTGATTGGTCTTTATCTTTGG - Intronic
1151753509 17:76056334-76056356 ATGTGATTGGGTTAGTGCTTTGG - Intronic
1152246273 17:79186292-79186314 GTGTGTTTGGCTTATTTCTTGGG + Intronic
1155227400 18:23740934-23740956 GTGTGCTTGGTTTAGGTCTAAGG - Intronic
1156167700 18:34443195-34443217 GTGTGATTAGGTAACATCTTTGG - Intergenic
1157874964 18:51264015-51264037 CTGTGATTGGCTTAGATCAGTGG + Intergenic
1163252105 19:16132059-16132081 GTTTGATTGGTTTGGTTGTTTGG + Intronic
1163856791 19:19708650-19708672 GTGTCCTTGGGTCAGATCTTTGG - Intergenic
927074386 2:19563127-19563149 GTGTGATTGGCATAAATCTCTGG + Intergenic
932561212 2:72872093-72872115 GTGTGCCTGGTCTAGATCTAGGG - Intergenic
934108549 2:88719440-88719462 ATGTCATTGTTTTAGATTTTAGG + Intronic
934682361 2:96293857-96293879 GTGTGATAGCTTTTGTTCTTGGG - Intronic
936677610 2:114733341-114733363 TTCTGATTGTTTTGGATCTTTGG + Intronic
936934033 2:117820602-117820624 GAGTGATTGGTTTACACCCTGGG + Intronic
941967016 2:171310689-171310711 CTCTGATTGGTTTAAAACTTGGG + Intergenic
944392687 2:199233878-199233900 TTGTGAGTGCTTTAGATTTTGGG + Intergenic
944492952 2:200276869-200276891 GTATGTTTTCTTTAGATCTTCGG - Intergenic
944745872 2:202655534-202655556 CTTTGCTTGGTTTAGATATTGGG + Intronic
945484866 2:210382773-210382795 GTGTGATTGGTTTTGAAATGTGG + Intergenic
946567089 2:220978415-220978437 ATATGATTGCTTTAGATGTTGGG - Intergenic
946671592 2:222110557-222110579 ATGTGATTGGCTGAGACCTTTGG + Intergenic
947374438 2:229481541-229481563 GTGAGATTTGTGTAGATCTTAGG - Intronic
948411904 2:237769928-237769950 TTGTGATTTCTTTAGATATTAGG + Intronic
1170487811 20:16837540-16837562 GTGTTTTTGGTGTAGTTCTTTGG + Intergenic
1170663385 20:18364012-18364034 GAGTTATTGGGTTAGATCATGGG - Intergenic
1170914482 20:20609507-20609529 GGTTGGTTGGTTTTGATCTTTGG - Intronic
1171374506 20:24683024-24683046 GTGGGATTGTTTTAGCTCTTTGG - Intergenic
1172262416 20:33579735-33579757 TTGAGATTGCTTTAGCTCTTTGG + Intronic
1177476555 21:21631468-21631490 GTGTACCTGGTTTATATCTTTGG + Intergenic
1178498040 21:33103403-33103425 GTGGGTATGGTTTAAATCTTGGG - Intergenic
1178997784 21:37421298-37421320 TTGTGATTGGTTTTTATTTTTGG + Intronic
1181876115 22:25942203-25942225 GTGTGTGTGGTTCAGAGCTTGGG - Intronic
1182339716 22:29609936-29609958 GTGTGATTTGTTTATATGCTTGG + Intronic
1182826970 22:33273908-33273930 AAGTGGTTGGTTTAGATCATCGG + Exonic
949179181 3:1106448-1106470 CTGTGTTTGATTTAGATCTGAGG + Intronic
953444285 3:42949469-42949491 GTGTGATTGGACAAGAACTTGGG + Intronic
956026578 3:64988932-64988954 GTGGGAGTTGATTAGATCTTGGG - Intergenic
957388146 3:79523953-79523975 GTGTGCTTATTTTAGATTTTGGG + Intronic
957507568 3:81143294-81143316 GTCTGAATGTTTTAGATATTTGG - Intergenic
965742644 3:171891877-171891899 TTGTGATTGGTTTCTTTCTTGGG - Intronic
966695874 3:182790610-182790632 TTTTGATGGGTCTAGATCTTGGG - Intergenic
968235188 3:197027195-197027217 CTGTGATTGGATTAGGTCTTGGG + Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
970957478 4:21831720-21831742 GTGTGAATTCTTTAAATCTTTGG - Intronic
971012373 4:22452603-22452625 GTTTGGTAGGTTTAGAACTTGGG - Intronic
971433080 4:26589332-26589354 TTGTGCTTGGCATAGATCTTAGG + Intronic
972104618 4:35467301-35467323 TTATGATTAGTTTTGATCTTTGG - Intergenic
975420907 4:74163780-74163802 GTTTAATTGCTTTATATCTTAGG - Intronic
976772155 4:88664958-88664980 TTGTCATGGGTTTGGATCTTTGG + Intronic
978128236 4:105160720-105160742 TGGTGCTTGGTTTAGCTCTTGGG - Intronic
979325544 4:119374813-119374835 GTTTGAGTGGTTTTGATCATGGG + Intergenic
981058540 4:140393943-140393965 GTGCTCTTGGTTTAGAGCTTTGG - Exonic
982304359 4:153914506-153914528 ATGTGATTATTTTGGATCTTGGG + Intergenic
983113830 4:163787100-163787122 GTTTTATAGTTTTAGATCTTTGG - Intronic
983243452 4:165259959-165259981 GTTTGAGTGGTTTTGATCATGGG + Intronic
983373991 4:166900192-166900214 GTGTCATATGTTTAGCTCTTTGG + Intronic
983537617 4:168874975-168874997 GTGTCATGTGTTTAAATCTTTGG - Intronic
983833304 4:172358799-172358821 GTGTGCTTGTTTTTGACCTTTGG + Intronic
984097966 4:175454797-175454819 CTGTTATTATTTTAGATCTTAGG + Intergenic
988615354 5:32769777-32769799 GTGAGAGTGGTCTAGCTCTTGGG - Intronic
990153042 5:52842157-52842179 TTGTGATTGGCTCAGATCCTAGG + Intronic
992421217 5:76607164-76607186 GTGTGTTTGGGTAAGGTCTTAGG + Intronic
994926373 5:106121787-106121809 GTGGGATGGGTTTGGATCATGGG - Intergenic
999334467 5:150703738-150703760 GAGTGGTTGGTTTGGATCCTGGG - Intergenic
999496922 5:152108178-152108200 GTGTGATTGTTTTAGATTGTAGG + Intergenic
1000000729 5:157136378-157136400 ATGTGTTTGGTATAGACCTTTGG - Intronic
1005228762 6:23674392-23674414 GTTTGTTTGTTTTAGAGCTTAGG - Intergenic
1008128863 6:47697979-47698001 GAGGGTTTGCTTTAGATCTTTGG + Intronic
1008513034 6:52295270-52295292 ATCTGACTGGTTTAGATCTTAGG + Intergenic
1010821850 6:80423396-80423418 CTGTGATTGGTTGAGAAATTTGG + Intergenic
1011323372 6:86121744-86121766 GTGTGATGGGATTGGATCATGGG + Intergenic
1012557570 6:100534260-100534282 GTTTGGTTGGTTTTGATTTTTGG - Intronic
1012615941 6:101280248-101280270 GTGTAATTGGTTATGATTTTGGG + Intergenic
1016261280 6:142173882-142173904 ATGGGATTTGTTTAGATATTAGG + Intronic
1016544828 6:145209374-145209396 TGGGGATTGGTTTAGACCTTGGG - Intergenic
1017558619 6:155602633-155602655 GTGTGGCTGGCTTAGATCTCTGG - Intergenic
1020857923 7:13452035-13452057 GTGGGATGGGATTAGATCATGGG + Intergenic
1035912612 8:3584309-3584331 GTGTGTTTGGTTTAGTTTTCTGG - Intronic
1039009501 8:33077107-33077129 TTTTGATTGGTCTAGAGCTTTGG - Intergenic
1040477284 8:47790934-47790956 GTTTTATTGGTTGAGATCTTAGG - Intronic
1044945228 8:97383130-97383152 GTGTGAGGTGTTTAGATCATGGG - Intergenic
1046402796 8:113728293-113728315 GTTTAATTGGATTAGATCATAGG + Intergenic
1046896934 8:119483347-119483369 GTGTGCTTGGATTAACTCTTTGG - Intergenic
1047010971 8:120672395-120672417 ATGTGATTTGTTTATTTCTTTGG - Intronic
1047173256 8:122515404-122515426 ATGTGATTTGTTTATAACTTCGG - Intergenic
1047622643 8:126623491-126623513 GAGTGATTGGTTTAGCTTCTGGG + Intergenic
1048128528 8:131664832-131664854 TTGTGATTTGTTGAGATCCTTGG - Intergenic
1048435137 8:134409350-134409372 TTGTTTTTGGTTTTGATCTTTGG - Intergenic
1050579422 9:7035604-7035626 GTTTTATTGTTTCAGATCTTAGG + Intronic
1050659890 9:7873105-7873127 GTATGTTTGGTTTTGATCATGGG + Intronic
1050809798 9:9729964-9729986 GTGAGATTGGTATATATGTTTGG + Intronic
1052141133 9:24985808-24985830 GTGTGATTATTTTTGCTCTTTGG - Intergenic
1052745648 9:32438217-32438239 GTCTGATGGGTGTAGATTTTAGG - Intronic
1052793812 9:32903598-32903620 GTGGGATTGGTTTCGTTCTGAGG + Intergenic
1060714636 9:125912571-125912593 GTATGATTTGTCTAAATCTTAGG + Intronic
1060752306 9:126180885-126180907 GTTTGTTTGTTTTAAATCTTGGG + Intergenic
1188400089 X:29733408-29733430 GTGTGATTGGTTTAAACCCCTGG - Intronic
1190121207 X:47660582-47660604 GTGTGATTGGAATAGATACTAGG + Intergenic
1190794605 X:53729267-53729289 GTATGAGTTGTTTAGATCCTCGG - Intergenic
1190991727 X:55557579-55557601 TTGAGATTGCTTTAGCTCTTTGG + Intergenic
1191663882 X:63678004-63678026 GTTGGTTTGGTTTACATCTTTGG + Intronic
1193115703 X:77773292-77773314 GGGTGGTTGGTTTTGAACTTTGG + Intronic
1194075224 X:89383066-89383088 GAGAGATTGGTTTACATCTAGGG + Intergenic
1195025387 X:100871829-100871851 GTGTGAGTGGTCTAGATCTAGGG - Intronic
1197253825 X:124241841-124241863 GATTGATTGGTTTAGATCAGGGG + Intronic
1197522416 X:127515566-127515588 TTATTATTGGTTTAGATTTTTGG - Intergenic
1198510330 X:137344012-137344034 TTGTCATTGGGTTGGATCTTTGG - Intergenic
1200730822 Y:6737233-6737255 GAGAGATTGGTTTACATCTAGGG + Intergenic