ID: 913024204

View in Genome Browser
Species Human (GRCh38)
Location 1:114819659-114819681
Sequence CAGAATATAGAGTTGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913024204_913024208 6 Left 913024204 1:114819659-114819681 CCTTTTTCCAACTCTATATTCTG No data
Right 913024208 1:114819688-114819710 TACACTGGTAGCTTGAAATTGGG No data
913024204_913024206 -9 Left 913024204 1:114819659-114819681 CCTTTTTCCAACTCTATATTCTG No data
Right 913024206 1:114819673-114819695 TATATTCTGTGACATTACACTGG No data
913024204_913024207 5 Left 913024204 1:114819659-114819681 CCTTTTTCCAACTCTATATTCTG No data
Right 913024207 1:114819687-114819709 TTACACTGGTAGCTTGAAATTGG No data
913024204_913024209 11 Left 913024204 1:114819659-114819681 CCTTTTTCCAACTCTATATTCTG No data
Right 913024209 1:114819693-114819715 TGGTAGCTTGAAATTGGGCATGG No data
913024204_913024210 14 Left 913024204 1:114819659-114819681 CCTTTTTCCAACTCTATATTCTG No data
Right 913024210 1:114819696-114819718 TAGCTTGAAATTGGGCATGGTGG No data
913024204_913024211 15 Left 913024204 1:114819659-114819681 CCTTTTTCCAACTCTATATTCTG No data
Right 913024211 1:114819697-114819719 AGCTTGAAATTGGGCATGGTGGG No data
913024204_913024212 30 Left 913024204 1:114819659-114819681 CCTTTTTCCAACTCTATATTCTG No data
Right 913024212 1:114819712-114819734 ATGGTGGGAGTATATATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913024204 Original CRISPR CAGAATATAGAGTTGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr