ID: 913029823

View in Genome Browser
Species Human (GRCh38)
Location 1:114890251-114890273
Sequence GGGTGAGCAAAATTTCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913029818_913029823 5 Left 913029818 1:114890223-114890245 CCTTAGAGTAATGGTGTCCAAAA 0: 1
1: 0
2: 0
3: 9
4: 158
Right 913029823 1:114890251-114890273 GGGTGAGCAAAATTTCCTTTAGG 0: 1
1: 0
2: 2
3: 14
4: 144
913029817_913029823 6 Left 913029817 1:114890222-114890244 CCCTTAGAGTAATGGTGTCCAAA 0: 1
1: 0
2: 0
3: 16
4: 149
Right 913029823 1:114890251-114890273 GGGTGAGCAAAATTTCCTTTAGG 0: 1
1: 0
2: 2
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913029823 Original CRISPR GGGTGAGCAAAATTTCCTTT AGG Intronic
902726461 1:18339309-18339331 AGGGGAGGGAAATTTCCTTTGGG - Intronic
908908539 1:69045654-69045676 GGATCAGCAAAATTACCTATTGG - Intergenic
910576763 1:88774239-88774261 GGGTGTGCAGAATTTTCATTGGG + Intronic
913029823 1:114890251-114890273 GGGTGAGCAAAATTTCCTTTAGG + Intronic
913161223 1:116147743-116147765 GGGTGAAAAAAATTCTCTTTAGG - Intergenic
913289787 1:117261550-117261572 GGCTGAGGAAACTTTCCTTTTGG - Intergenic
913572018 1:120130294-120130316 GGGTAAGCAAAATATTCTTAGGG + Intergenic
914292939 1:146291930-146291952 GGGTAAGCAAAATATTCTTAGGG + Intergenic
914553983 1:148742713-148742735 GGGTAAGCAAAATATTCTTAGGG + Intergenic
920073801 1:203322219-203322241 GGTTAAGCAAAATTACCTATGGG + Intergenic
1064877348 10:20009378-20009400 GTGTGTGAAATATTTCCTTTTGG + Intronic
1068752073 10:60606258-60606280 GGTTGAGGAACATTTTCTTTTGG + Intronic
1070842149 10:79494766-79494788 GGGTGAGGCAAATATCCCTTTGG - Intergenic
1071203421 10:83246906-83246928 GGGAAAGCAAGGTTTCCTTTAGG + Intergenic
1071384745 10:85107745-85107767 GGGTGAGCACAATTATGTTTTGG - Intergenic
1072127448 10:92459757-92459779 AGGATAGCAAAATTTCCATTAGG - Intronic
1073407331 10:103309338-103309360 GGTTTAGCACAATTTCCCTTTGG + Intronic
1075007021 10:118838555-118838577 GGCTGAGCAAAGCTTCCTTGAGG + Intergenic
1076469903 10:130711080-130711102 GGGTGAGCACAAATTTCTGTTGG + Intergenic
1078825770 11:14929127-14929149 GGGTGAGAAATATTTCCTATAGG + Intronic
1085922695 11:80977846-80977868 GGTTGTGCCAACTTTCCTTTTGG - Intergenic
1088456347 11:110036609-110036631 GGGTGTGTCAAATCTCCTTTGGG + Intergenic
1088968495 11:114750010-114750032 GGGTGAGAAGAATGTCCTCTTGG - Intergenic
1090592038 11:128282438-128282460 GGGTTAGAAAAACTTCCTTCAGG + Intergenic
1090994207 11:131850611-131850633 GGATTAGCTGAATTTCCTTTGGG + Intronic
1096158535 12:49356935-49356957 GGGTGAGCCACCTTTCCATTAGG + Intronic
1096978680 12:55716195-55716217 GGGTGAGCCAAATATCCTGTCGG + Exonic
1097632268 12:62078766-62078788 GCCTGAGAAAAATTTCTTTTTGG + Intronic
1097770632 12:63580456-63580478 GGGGGTGCAAAATTGCCTTTTGG + Intronic
1098080364 12:66778255-66778277 GTGTGTGTAAAATTTCTTTTTGG - Intronic
1098681682 12:73364088-73364110 GGTTGAGTAAAATTTCTTCTCGG - Intergenic
1100226712 12:92564509-92564531 GGGTGTGCATAATTTCCCGTAGG - Intergenic
1101705208 12:107214982-107215004 GGGTGCCCAAAATTTAATTTGGG - Intergenic
1103956553 12:124580390-124580412 TTGTGAGCAGATTTTCCTTTTGG - Intergenic
1104205425 12:126634320-126634342 GTATGAGCAAATTTTCCTTCAGG - Intergenic
1107399177 13:40052089-40052111 GGGTTAACAAAATTTGATTTTGG + Intergenic
1107410130 13:40150740-40150762 TGGTGTGCACCATTTCCTTTGGG + Intergenic
1110437020 13:75486558-75486580 GGGTGGGTAGAATTTCCTTTTGG - Intergenic
1111803565 13:93009709-93009731 GGGTGAGCAAACTTTTCCTAAGG - Intergenic
1112207846 13:97343108-97343130 TGGTGGGCAGAATTTCCGTTGGG - Exonic
1114351130 14:21852602-21852624 GAGTGAGTAAAATTTCTTTATGG + Intergenic
1114728865 14:24969150-24969172 GGGAGAGCAAAATTTTCTTTAGG - Intronic
1115331176 14:32200587-32200609 GGGTTAGCAATAATTCCTGTGGG + Intergenic
1115374660 14:32661049-32661071 GGGAGAGTAACATTTCATTTTGG + Intronic
1115905714 14:38201079-38201101 GGAAGAGCAAAATTTTATTTTGG + Intergenic
1116716862 14:48438586-48438608 GTGTGGGAAAAATTTCTTTTAGG + Intergenic
1117597310 14:57336427-57336449 GAGTGAGCAAAATTTCCTGTAGG + Intergenic
1117690846 14:58303711-58303733 GGGTGGGGAAAATTTGCATTTGG - Intronic
1120593474 14:86404759-86404781 GGTTGAGAAAAAATTTCTTTAGG - Intergenic
1120669208 14:87344741-87344763 GGGGAAGCCAAATTTTCTTTAGG + Intergenic
1122745888 14:103896997-103897019 GGGTGAACAAAGCATCCTTTGGG - Intergenic
1123152764 14:106198867-106198889 AGGGGACCAAAATTTTCTTTTGG + Intergenic
1125383320 15:39110828-39110850 TGGTGGGCAAAATTGCCTTCTGG - Intergenic
1127660379 15:61095087-61095109 GGATGAACAGAATGTCCTTTGGG + Intronic
1128549207 15:68586906-68586928 GCCAGAGCAAAGTTTCCTTTTGG - Intronic
1129125945 15:73441540-73441562 GGGTGAGAAAAATTTCCCGAGGG - Intergenic
1130794079 15:87190014-87190036 GGCTGACCAAAATCTCTTTTTGG + Intergenic
1131884486 15:96897173-96897195 GGTTGAGCTAGATTTCCTTTAGG + Intergenic
1132337162 15:101055327-101055349 GAGTGAGAAAAATGTGCTTTTGG - Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1139754845 16:69133932-69133954 TGGTAAGCAAAATTTCCTGCAGG + Intronic
1143707013 17:8705645-8705667 GGGGGAGGAACATTTCATTTGGG - Intergenic
1143864403 17:9913444-9913466 GGCTGAGCCAAAGTCCCTTTTGG - Intronic
1144604691 17:16653969-16653991 GGGTGAGAAAAAATTCCAATTGG + Intergenic
1155709100 18:28853561-28853583 GGATCAGCAAAAATTCCTATTGG + Intergenic
1156794876 18:41032101-41032123 GAATGTGCAAAATTTCCTATAGG - Intergenic
1156924543 18:42559618-42559640 GGGTGAGTAAAATTTTTTTTTGG + Intergenic
1157282281 18:46353948-46353970 GGGTGAGCTAAATATCTTTGGGG - Intronic
1159616488 18:70585917-70585939 GTGTCAGCAATATCTCCTTTGGG - Intergenic
1160668236 19:343667-343689 GGGTGGGCACCTTTTCCTTTGGG + Intronic
1161751528 19:6100907-6100929 GGGTGAGTAAAAATTACTTCTGG - Intronic
1163401949 19:17099392-17099414 GGGTGAACAAATTTCCCGTTGGG + Intronic
1168198357 19:54792988-54793010 CGGTCATCAGAATTTCCTTTAGG + Intronic
925676178 2:6363323-6363345 GAGTGAGAAAAAAGTCCTTTTGG - Intergenic
928260439 2:29761797-29761819 GGGTGAGCAATCTCTCCCTTTGG + Intronic
935293586 2:101629471-101629493 GGATGAGCACTATTTCCATTTGG - Intergenic
937031219 2:118742410-118742432 TGGTGAGGAAAACTTCTTTTAGG - Intergenic
939473132 2:142650850-142650872 GAGTGAGCATATTTTCCTGTAGG - Intergenic
940742698 2:157528368-157528390 TGGAGAGAAAAATTTCTTTTAGG + Exonic
941211804 2:162648772-162648794 GAGTGAGCAAAATTTTTTTGGGG - Intronic
944866622 2:203869019-203869041 GGTTGAGATAAATTTACTTTAGG - Intronic
945502208 2:210589952-210589974 TGCTGAGCAAAAATTTCTTTGGG - Intronic
945768312 2:214008145-214008167 GGGTGAGCAAAATATCAGATTGG - Intronic
945862573 2:215140474-215140496 GAATGAGCACAATTTCATTTTGG - Intergenic
946462928 2:219885954-219885976 TGGAGAGCAAACTTTTCTTTTGG - Intergenic
947172700 2:227326516-227326538 GAGAGAACACAATTTCCTTTTGG - Intronic
947874023 2:233456690-233456712 TATTGAGCAAAATTTCCTATTGG + Intronic
948257246 2:236577360-236577382 GGGTGACGAAAATTTGATTTAGG - Intronic
948330178 2:237158373-237158395 GGGTGAGCGACATTACCTCTTGG - Intergenic
1174721639 20:52819174-52819196 GGGTTTGCAAACTGTCCTTTAGG - Intergenic
1175461326 20:59153765-59153787 GGGAGAGCAAAAATTGCTTGTGG - Intergenic
1177055175 21:16292775-16292797 GTGTGAGCAAAATTAACTCTAGG - Intergenic
1180592854 22:16955707-16955729 GGGTGAGGAGAAGCTCCTTTGGG + Intergenic
1182402036 22:30085945-30085967 GGCTTAGTAAAATTTCCTTAAGG - Intronic
952225361 3:31369907-31369929 GAGTCAGCAATATTTCCTTCTGG - Intergenic
953860314 3:46538773-46538795 GAGTGAGCAATATTTTATTTAGG - Intronic
954506346 3:51078713-51078735 GAGTGACCAAAATTTTCTTTAGG - Intronic
959868620 3:111300962-111300984 AGGTAAGCAAAATTTTATTTTGG - Intronic
962083761 3:132168576-132168598 GTGTGAGCCAAATTTCCTTCTGG - Intronic
964366235 3:155953521-155953543 GGGTGTGCAAAATATCTCTTGGG + Intergenic
964866240 3:161265149-161265171 GGTGGAGCAAAAGTTCGTTTGGG + Intergenic
965336975 3:167438216-167438238 CTGTGAGCATAATTTCCTTCAGG - Intergenic
965506955 3:169526921-169526943 GGATCACCAACATTTCCTTTAGG - Intronic
965788131 3:172358100-172358122 GCGTGAGCAGAACTCCCTTTAGG - Intronic
965903076 3:173668179-173668201 CAGTGATCAAAATTTCCTTAGGG + Intronic
966553797 3:181235144-181235166 GGCTAGGCAAATTTTCCTTTGGG + Intergenic
966974850 3:185074540-185074562 GGGACAGCAAAAATCCCTTTGGG + Intergenic
967286214 3:187873033-187873055 GGGTGAGGGACATTTGCTTTTGG + Intergenic
969539087 4:7774646-7774668 TGGTGAGCAATAGGTCCTTTGGG + Intronic
970230603 4:13906748-13906770 GGATGAGAAAGATTTCCTTGAGG - Intergenic
972921255 4:43945010-43945032 GGGTGAACAAGTTTTCCTTGAGG - Intergenic
974655569 4:64815569-64815591 GAATGAGCTAAATTTCCTATAGG - Intergenic
976861226 4:89669403-89669425 GGGTGAGCGAAATCTCATTGTGG + Intergenic
976972277 4:91118938-91118960 GGGTAAGGAAAATCTGCTTTGGG + Intronic
977012173 4:91650775-91650797 GGATGATTAAAAATTCCTTTAGG - Intergenic
977201707 4:94123959-94123981 GGAAGAGTAATATTTCCTTTAGG + Intergenic
977707996 4:100092910-100092932 TGGTGAGAAACTTTTCCTTTCGG - Intergenic
979419336 4:120484526-120484548 GGGTGAGCAATGTTGTCTTTTGG - Intergenic
981191333 4:141867875-141867897 GGGTCAGCAGATTTTCTTTTAGG + Intergenic
985157051 4:187000389-187000411 CTGAGAGCAAAAATTCCTTTTGG + Intergenic
988837933 5:35051748-35051770 GGTTGAGAATATTTTCCTTTTGG - Intronic
989266217 5:39476992-39477014 GCATGAGGAAATTTTCCTTTAGG + Intergenic
991001494 5:61788044-61788066 GGGCAGGCAAAAATTCCTTTGGG + Intergenic
997234167 5:132263244-132263266 GGGGTAGCAAAATTTGATTTTGG + Intronic
1001004327 5:168036884-168036906 GGGGGAGGATAATTTCTTTTTGG - Intronic
1001373792 5:171234751-171234773 GGGGGACCAAAGTTCCCTTTTGG + Intronic
1003041952 6:2696475-2696497 GAGTGAGCAAACTTTCATTTTGG - Intronic
1006297064 6:33174403-33174425 GGGTCAGCTAAATTCCCTCTGGG + Intronic
1007104663 6:39275311-39275333 GGATGAGCAAAAGTTCCATCTGG + Intergenic
1008135055 6:47765372-47765394 GGGTGAAAAACATTTCCTTGAGG + Intergenic
1010108607 6:72197474-72197496 GGGTGAACAAATTTCCCTGTGGG - Intronic
1010664566 6:78613372-78613394 GGGTGAGCAAAATCCAGTTTAGG - Intergenic
1012403799 6:98869682-98869704 GAGTCAGTAAAATTTCCATTTGG - Exonic
1013266050 6:108499917-108499939 GGGTTAGAAAAATTACCTATTGG - Intronic
1015254700 6:131165017-131165039 AGGTAAGCAAAATTTCTTTATGG - Intronic
1015979622 6:138825931-138825953 GGGGGAGAAAAAATTCATTTTGG - Intronic
1020382926 7:7566378-7566400 GGGTCAGCAAAGCTTCCTTAAGG - Intergenic
1022199803 7:28105217-28105239 GGGTCAGCAAAATTGTCTTCAGG - Intronic
1022613727 7:31906463-31906485 GAGTGAGGTACATTTCCTTTGGG + Intronic
1022930113 7:35102719-35102741 GGGGGTGCAAAATTGCCTTTTGG + Intergenic
1026370467 7:69693352-69693374 GCATGAGTTAAATTTCCTTTTGG - Intronic
1028923712 7:96334739-96334761 TAGGGAACAAAATTTCCTTTTGG - Intergenic
1032948736 7:136882723-136882745 GCCTGAGCAAAATTTCCTCTAGG + Intronic
1033932021 7:146535732-146535754 GGGTTAGAAAAGTATCCTTTGGG - Intronic
1034737601 7:153443513-153443535 GGGAGAGCAAAAGTTCCCTATGG - Intergenic
1038081145 8:24137699-24137721 GAGGGAGAAAAATATCCTTTTGG + Intergenic
1041956422 8:63561594-63561616 GGGTGAGCAAAAATGACTTATGG - Intergenic
1042153566 8:65816898-65816920 GGGTCAGAAAAATGACCTTTTGG - Intronic
1042450874 8:68943960-68943982 GGGAGGGCAAAATCACCTTTGGG - Intergenic
1043024996 8:75055488-75055510 GGGTGGGCTAAATTTTCTTGTGG + Intergenic
1046461358 8:114541618-114541640 GGATGAGCAAAATTACCACTGGG + Intergenic
1047035363 8:120932472-120932494 GGGTGAGAGAAATGTACTTTAGG + Intergenic
1049559775 8:143304047-143304069 GGGTGAAAAAAATTGCCTTTGGG - Intergenic
1050399373 9:5235020-5235042 GAGAGAGCAAAATTTCCCTAAGG + Exonic
1051988548 9:23121795-23121817 GAGGGAGTAAAATTTCATTTTGG - Intergenic
1052242721 9:26293753-26293775 GGGTGAGCACATTTTCCCTTGGG + Intergenic
1053150264 9:35738772-35738794 GGGTGATCAAAACTTCCTGAAGG - Exonic
1059758147 9:117312949-117312971 GGGTTTGCAAATTTTCATTTGGG - Intronic
1060271017 9:122141599-122141621 GAGTCAGATAAATTTCCTTTGGG + Intergenic
1186811278 X:13191221-13191243 CGGTGAGGAAAAAATCCTTTGGG - Intergenic
1189391884 X:40583341-40583363 GGCTGAGGAAAATTTCCCATGGG + Intronic