ID: 913031904

View in Genome Browser
Species Human (GRCh38)
Location 1:114915825-114915847
Sequence TAGGATAAGTACTCTGTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913031904_913031908 2 Left 913031904 1:114915825-114915847 CCGGCAACAGAGTACTTATCCTA 0: 1
1: 0
2: 2
3: 8
4: 99
Right 913031908 1:114915850-114915872 AGCAGCACAGTGGTAGCCAAGGG 0: 2
1: 0
2: 1
3: 34
4: 359
913031904_913031910 21 Left 913031904 1:114915825-114915847 CCGGCAACAGAGTACTTATCCTA 0: 1
1: 0
2: 2
3: 8
4: 99
Right 913031910 1:114915869-114915891 AGGGTCTCTGTCTGCAAGACAGG 0: 2
1: 1
2: 4
3: 61
4: 938
913031904_913031907 1 Left 913031904 1:114915825-114915847 CCGGCAACAGAGTACTTATCCTA 0: 1
1: 0
2: 2
3: 8
4: 99
Right 913031907 1:114915849-114915871 TAGCAGCACAGTGGTAGCCAAGG No data
913031904_913031905 -8 Left 913031904 1:114915825-114915847 CCGGCAACAGAGTACTTATCCTA 0: 1
1: 0
2: 2
3: 8
4: 99
Right 913031905 1:114915840-114915862 TTATCCTATTAGCAGCACAGTGG 0: 2
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913031904 Original CRISPR TAGGATAAGTACTCTGTTGC CGG (reversed) Intronic
903073429 1:20741778-20741800 TAGCTTCAGTACTCTGTTGGTGG - Intergenic
904371128 1:30048020-30048042 TAGGCTAAGTTCTCTGCTGAAGG - Intergenic
913031904 1:114915825-114915847 TAGGATAAGTACTCTGTTGCCGG - Intronic
914984199 1:152442205-152442227 TAGGATAAGGACTCTGTGCTTGG + Intergenic
923265399 1:232308871-232308893 TTGGAAAAGTGCTCTGATGCAGG - Intergenic
923557660 1:235013418-235013440 TTGGATATTTACTGTGTTGCAGG - Intergenic
1070122302 10:73589981-73590003 GAGGATAAGTAATCTGCTGAAGG - Intronic
1074586787 10:114775421-114775443 AAGGATTATTCCTCTGTTGCTGG + Intergenic
1075979748 10:126727153-126727175 AAGGAGAAGAACTCTGTTGGGGG + Intergenic
1081003572 11:37704244-37704266 AAGGATAAGAATTCTGATGCTGG - Intergenic
1084758436 11:71252946-71252968 TATTATAAATACTCTGTGGCGGG - Intergenic
1088305000 11:108398354-108398376 TAGGATAAGCCCTCTGTTTCTGG + Intronic
1090799801 11:130163252-130163274 TAGGAAGAGGTCTCTGTTGCTGG - Intronic
1093702602 12:22239086-22239108 TAGTATAATTATTCTTTTGCAGG + Intronic
1094193174 12:27717583-27717605 GAGAATGGGTACTCTGTTGCTGG + Intronic
1095634649 12:44418944-44418966 AAGAATAAGTATTCTGTTGTTGG + Intergenic
1098085444 12:66837664-66837686 TAGGAAAATTACTCTGTTGGTGG + Intergenic
1099171485 12:79370108-79370130 GAGTATAGGAACTCTGTTGCCGG - Intronic
1104019008 12:124979431-124979453 CAGGATGAGTATTCTGTTGCTGG - Intronic
1106186075 13:27411037-27411059 CAGGATAAGGGCTCTGTAGCAGG + Intergenic
1106967321 13:35086661-35086683 TTGGATAAATACTCAGTAGCAGG + Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112695190 13:101940081-101940103 CAAGATAAGTCCTCTTTTGCAGG - Intronic
1120080844 14:80214436-80214458 TAGAATTAGGACTCTGTTGGGGG + Intronic
1121839830 14:97124289-97124311 TAAGACAAGTCCTCTGTGGCAGG + Intergenic
1128854486 15:70997010-70997032 AAGAATATGTATTCTGTTGCTGG + Intronic
1130520813 15:84659250-84659272 TAGCATAAGTACTCTGTGGCCGG + Intergenic
1132627672 16:899463-899485 TAGGATAATTACTCTCGTTCTGG + Intronic
1134771868 16:16816109-16816131 TAGGTGAAGGACTCTGTTTCAGG - Intergenic
1137531073 16:49279506-49279528 TTGGATTAGGACTCCGTTGCTGG + Exonic
1147445354 17:40471967-40471989 TTGGATAAGGACTCTCTTCCTGG - Intergenic
1154460304 18:14576982-14577004 TTGGACATGTACTCTGTTTCAGG + Intergenic
1157211393 18:45745509-45745531 TATGATAAGTGCCCTTTTGCTGG + Intronic
926333311 2:11843888-11843910 TTGGATATGTACTCTGTGTCAGG - Intergenic
929372152 2:41238733-41238755 TAGAATGTGTAATCTGTTGCTGG + Intergenic
930837706 2:55812147-55812169 TAGCACACGTACTCTGTTCCAGG + Intergenic
930912802 2:56650195-56650217 TGGGGTAAGTTCTCTTTTGCTGG + Intergenic
931577073 2:63729478-63729500 TAGGAGAAGTAGCCTGTTGAAGG + Intronic
936857181 2:116972845-116972867 TAGGTTGTTTACTCTGTTGCTGG + Intergenic
937782942 2:125860166-125860188 TAAGAGAATTACTCTGTTTCTGG - Intergenic
940654702 2:156473986-156474008 AAGCATATGTACTCTGCTGCTGG - Intronic
942433228 2:175939401-175939423 TTGAATATGTACTCTTTTGCAGG + Intronic
942740350 2:179169611-179169633 CAGAATAAGTATTCTGTTGTTGG - Intronic
943561702 2:189471696-189471718 TAGGATGACTACTGTGTAGCAGG - Intronic
943663418 2:190583824-190583846 TAGGAAAAGTACTAAGATGCTGG + Intergenic
1172133592 20:32672854-32672876 TAGGAAAAGGTCTCTGCTGCCGG - Intergenic
1172202673 20:33137959-33137981 CAGGATAAGAATTCTGTTGTGGG - Intergenic
1174304595 20:49606035-49606057 TCGGACAAGGACTTTGTTGCAGG + Intergenic
1176813805 21:13575838-13575860 TTGGACATGTACTCTGTTTCAGG - Intergenic
1177075917 21:16573253-16573275 TAGGATAAGTAGTCTGTGTCAGG - Intergenic
949645157 3:6084934-6084956 TATGATAGGGCCTCTGTTGCAGG + Intergenic
949859835 3:8494940-8494962 TAGGTTAAGTAAGCTGTTCCAGG - Intergenic
950505174 3:13390123-13390145 TAGGAAACGAACACTGTTGCCGG - Intronic
951076606 3:18401110-18401132 CAGGATGAGTGCTCTGCTGCAGG - Intronic
952123203 3:30268801-30268823 AAAGTTAATTACTCTGTTGCGGG + Intergenic
953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG + Intergenic
954834487 3:53453735-53453757 TCGGATATGGTCTCTGTTGCTGG + Intergenic
957884013 3:86259615-86259637 TAGTATAATTACTCTATGGCCGG - Intergenic
960891889 3:122457780-122457802 TTGGATCAGGACTCTGTTGCTGG + Intronic
961513906 3:127421027-127421049 CAGGGTGAGTACTCTGTTGGAGG - Intergenic
965377858 3:167948652-167948674 TTGGATATGTACCCAGTTGCGGG - Intergenic
965698313 3:171433478-171433500 TAATATAAGCACTCTGTTTCAGG - Intronic
966642257 3:182204123-182204145 TAGGAGAATAACTCTGTAGCAGG - Intergenic
969851972 4:9964564-9964586 GAGGATAAGGACGATGTTGCTGG + Intronic
973095076 4:46187030-46187052 GAGGTTAAGTACTCTGTAGAAGG - Intergenic
975504186 4:75120152-75120174 TTGGATAAATACTCAGTAGCGGG - Intergenic
980548468 4:134301912-134301934 CAGGAAAAGCACTCTGTTCCAGG - Intergenic
983054113 4:163081978-163082000 TAAGATAAGTACCATGTGGCCGG + Intergenic
985349127 4:189038945-189038967 TAGGATAAATGATCTCTTGCAGG - Intergenic
985959938 5:3293718-3293740 TAGGATTTGTACCCTGTTCCAGG + Intergenic
989545912 5:42672959-42672981 TAGGCTGTTTACTCTGTTGCTGG - Intronic
990123285 5:52482948-52482970 GAGGTAAAGTTCTCTGTTGCAGG + Intergenic
990361360 5:55023859-55023881 TAGCATAAGTACTCTGATACAGG + Intergenic
996318533 5:122188448-122188470 AAGGTTTAATACTCTGTTGCAGG + Intergenic
1000540398 5:162531717-162531739 AAGAATTAGTATTCTGTTGCTGG - Intergenic
1001228706 5:169967456-169967478 TAGTATAAGTTCTGTGTGGCCGG + Intronic
1008050281 6:46893871-46893893 TAAGATAAGTGCTGTGTGGCTGG - Intronic
1008218812 6:48828643-48828665 TATGATTAGGACACTGTTGCTGG + Intergenic
1009167199 6:60355616-60355638 TAGTAGAAGAGCTCTGTTGCAGG + Intergenic
1009427361 6:63528799-63528821 TAGTATAAATACTCTGTGGAGGG - Intronic
1011819300 6:91231953-91231975 TATGATAAGTAATCTGTTTATGG - Intergenic
1012071032 6:94616673-94616695 TAGAATAAATTCACTGTTGCAGG + Intergenic
1012619644 6:101326490-101326512 TAGAATATGTATTCTGTTGTTGG + Intergenic
1012623896 6:101382951-101382973 GAGGAAAAGTTCTGTGTTGCTGG - Intergenic
1013223173 6:108098247-108098269 TTGGATAAGTACTCAGTAGTGGG - Intronic
1016256732 6:142115531-142115553 TAGGATTATTACTCTGGTGCTGG + Intergenic
1017065797 6:150527939-150527961 TAGGATCAGTAATCTGCTCCAGG - Intergenic
1017705268 6:157116654-157116676 GAGGAAATGTATTCTGTTGCTGG + Intronic
1018199105 6:161378958-161378980 TGGCAAAAGTACTCTCTTGCTGG - Intronic
1020729140 7:11858389-11858411 TAGAATAAGTACTATGTTGCTGG - Intergenic
1028668610 7:93375257-93375279 TAGTATATGTACTTTATTGCTGG - Intergenic
1033806694 7:144962347-144962369 TAGAATAAATCCTGTGTTGCTGG - Intergenic
1034321101 7:150183224-150183246 TAGGGTAACTACTGTGTTCCAGG + Intergenic
1034771645 7:153784021-153784043 TAGGGTAACTACTGTGTTCCAGG - Intergenic
1035348612 7:158226744-158226766 TAGGGTAAGTGCTGTGTTGTGGG - Intronic
1035590500 8:809432-809454 TAGGGTAAGTACTCTGTCTCTGG + Intergenic
1039812741 8:41064055-41064077 TAGGATGATTACCTTGTTGCTGG + Intergenic
1041721825 8:60983100-60983122 TAGGATGGATACTCTGTTTCCGG + Intergenic
1042095986 8:65216631-65216653 TAGAGTAAGTACTTTGTTCCTGG + Intergenic
1046783894 8:118245300-118245322 TTGAATAAGTTCACTGTTGCTGG - Intronic
1050574570 9:6979958-6979980 TAGGATGAGAACTCTGTGGTGGG + Intronic
1052036475 9:23686984-23687006 AAAGATCAGTATTCTGTTGCTGG + Intergenic
1054898156 9:70337423-70337445 TAGGATAAATACTGTGTTTTGGG + Intronic
1059557859 9:115299471-115299493 TAGAATAAGTATTGTGTTGTAGG + Intronic
1060438148 9:123613941-123613963 AAGGAAAAGGGCTCTGTTGCTGG + Intronic
1187452925 X:19414363-19414385 TATGATAATTATTTTGTTGCCGG - Intronic
1190588026 X:51967033-51967055 TTGTATAAGTACTGTGTTGGCGG + Intergenic
1192637666 X:72834875-72834897 TTGGATAAATACTCAGTTGAGGG - Intronic
1192644048 X:72885940-72885962 TTGGATAAATACTCAGTTGAGGG + Intronic
1195570165 X:106391856-106391878 TAGGATAAGAAGTCTGATCCTGG - Intergenic