ID: 913032117

View in Genome Browser
Species Human (GRCh38)
Location 1:114918450-114918472
Sequence CAGAATAGCCCAAGATATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913032117_913032121 7 Left 913032117 1:114918450-114918472 CCAGAATATCTTGGGCTATTCTG No data
Right 913032121 1:114918480-114918502 TGTGGTTCTATATAAATTTTAGG 0: 26
1: 447
2: 1194
3: 2272
4: 2780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913032117 Original CRISPR CAGAATAGCCCAAGATATTC TGG (reversed) Intronic
No off target data available for this crispr