ID: 913039442

View in Genome Browser
Species Human (GRCh38)
Location 1:115008352-115008374
Sequence CTTGTCCTGTTACTGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913039442_913039447 23 Left 913039442 1:115008352-115008374 CCAAATCCCAGTAACAGGACAAG No data
Right 913039447 1:115008398-115008420 GTTATCTACAGAAGATAGCAGGG No data
913039442_913039445 -6 Left 913039442 1:115008352-115008374 CCAAATCCCAGTAACAGGACAAG No data
Right 913039445 1:115008369-115008391 GACAAGAGCTGTCTCTCAAAAGG No data
913039442_913039446 22 Left 913039442 1:115008352-115008374 CCAAATCCCAGTAACAGGACAAG No data
Right 913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913039442 Original CRISPR CTTGTCCTGTTACTGGGATT TGG (reversed) Intergenic
No off target data available for this crispr