ID: 913039443

View in Genome Browser
Species Human (GRCh38)
Location 1:115008358-115008380
Sequence ACAGCTCTTGTCCTGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913039443_913039446 16 Left 913039443 1:115008358-115008380 CCCAGTAACAGGACAAGAGCTGT No data
Right 913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG No data
913039443_913039447 17 Left 913039443 1:115008358-115008380 CCCAGTAACAGGACAAGAGCTGT No data
Right 913039447 1:115008398-115008420 GTTATCTACAGAAGATAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913039443 Original CRISPR ACAGCTCTTGTCCTGTTACT GGG (reversed) Intergenic
No off target data available for this crispr